Microarray Probes on PGSC0003DMT400008034

Probe IDChipProbe Sequence
CUST_41378_PI426222305 JHI_St_60k_v1 GAGTATTCATAATATATCAAGTTCATGAGGGCTTTGTGAAGCTTCTCACTTTACTGTCTC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400008034

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400008034 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G58290.1 +2 0.0 632 349/491 (71%) Glutamyl-tRNA reductase family protein | chr1:21624028-21626051 REVERSE LENGTH=543

Transcript Sequence (2196 bp)

>PGSC0003DMT400008034 2196 pgsc_dm_v3.4
ATTCCACCATTATTATCGTCGATTCCGTCCAAATAAATAAAATTGCCTAATTATATTAGC
CCACCACTCACCAATTATTGTTTTTTTTTATACCAAACCCATCACCTCCATACCTATTCC
ATTCTGTCACCTGTTCCGAATTTCGATTACAAATCTGGGTTTCGGAGCTCTCTCGCCATA
GCCGCTATTGCTGTTTTCTACAAATTGTGTTTCAATGGCGGTTGCGAGTAGCTTTGTGAC
AGGTGGCAGTTTCAATTGTGATTATTTAAGTTCTACGTCTTGTTCTTCGTCGTCTTCTCC
TTCTGTGGATCATCAAGTTAGATTTTTCGGGAGTCGTCGAAGAATTAAGCCGCTGGTATA
TTGGACGAGATCGCATTCGTTGAGCCCTAAATGTGAGTTATCATCCAACTCGGTGGTGAA
AAATGGCAAAAAGGAATCTAGAACATCGAGTCTTTCTGCTTTGGAACTTCTCAAAACATC
TGCTGCTGATCGATATACAAAGGAGAGTAGCAGCATCATGGTTATTGGACTTAACATTCA
CACAGCACCAGTTGAAGTGCGGGAGAAAGTTTCTATCCCAGAAGCACAATGGCCTCAAGC
AATTCGCGAACTGTGTTCCTTGAATCATATAGAGGAAGCTGCTGTATTGAGTACTTGTAA
CAGAATTGAAATATATGTTTTGGCGCTTGCCCAAAATCGTGGAATTAAAGAAGTGACTGA
GTGGATGTCTAAGTTTAGTGGAGTTCCAGTTACAGAGCTATGCCAACACCGGTTTTTGCT
ATACAATCAAGATGCCACACAACACCTGTTTGAAGTAGCTGCTGGACTAGATTCCCTAGT
CCTGGGAGAAGGTCAAATTCTTGCACAGGTCAAGCAGGTTGTTAAGAATGGGCAGGGGGT
CCCTGGCTTTGGTAGGAAAATAAGTGAGCTATTTAAGCGTGCAATCACAACTGGTAAGAG
GGTAAGAACTGAGACCAATATCTCCAGCGGATCAGTATCAGTCAGTTCAGCGGCGGTGGA
GCTTGCTCTGCTGAAACTTCCAGAGTATTCTTCTTCTACGGCTCGTGTGTTAATTGTTGG
AGCTGGCAAGATGGGAAAGCTTGTGATCAGACATTTGGTTGCTAAAGGGTGTAAAAAGAT
GGTTGTCGTTAACAGGACAGCGGACAGAGTTGCTGCCATCCGTGAGGAGTTGATGGATGC
TGATATAGTATACAAGCCTTTCTCAGAATTATTAGCATGTGCTGCTCAGTCTGATGTAAT
ATTCACCTGCACTGCTTCGAAAGCTCCTTTATTCATAAAGGAGAGTGTTCAAGCTCTCCC
TTCTGTGAACTCTGAAGATGGGTGCCGGAGGCTATTTATTGATATTTCTGTTCCTCGGAA
TGTGGAACCTAGTGTCGCAGAACTTGAAGGTGCAGGTGTTTACAATGTGGATGATCTTAA
AGAGGTTGTGGAAGCTAATAAGGAGGATCGGTTGCGGAAGAAAATGGAAGCTGAGACCAT
CATTGCTGAGGAAGTGAAACAATTTGAAGCACTTAAAGACTCCCTTGAGACCGTTCCAAC
TATAAAAAAGCTCAGGGCATATGCTGAAAGAATTAGGTCTGCTGAGGTTGACAAATGTTT
GTCTAAGATGGGTGATGATATCCCCCAAAACAAGAAGAAGGCTATCTATGATCTCAGTCT
AGGGATAGTAAACAAGCTGCTACACGGACCAATGCAGCATCTAAAATGTGATGGAGCTGA
AAACCGAACTTTGAGTGAAATACTTGAAAATATGCACGCTCTTAACAGAATATTTGGTCT
TGATACTGAGATGTCTGTATTGGAAGAGAAAGTACGAGCCAAGATAGAACAAAATCAAAA
GCAATCCTCTTGAGGTTCTTTTTCCATTCAGCTAGAAAAGGTCAATAACGTTCAGCAAAG
TTCAATCAGGAATGATCATCGTTTCAGATCCTTTCCTGACAGTTTGCTAGTTTTAACTGT
ATCAAATTAGAGTACACAGAACACGATGAGATTATTTTTTTTAGGCCATAGGTAGCCAAC
ATTACACGAGGGATTCCCTCAGATTGCGGGAAAGTCTGCCATAGTTGCAGTTGTATTTCT
TACGGAAGAGTATATATCCATTTGTTGAATCCAGAGGAGTATTCATAATATATCAAGTTC
ATGAGGGCTTTGTGAAGCTTCTCACTTTACTGTCTC