Microarray Probes on PGSC0003DMT400007377

Probe IDChipProbe Sequence
CUST_11209_PI426222305 JHI_St_60k_v1 GGTCAAACGTGTCTTTCAGAGTTCAACTTTGAAAAAAGTGAAAAGATTTCACAACCAAAC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400007377

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400007377 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G01470.1 +3 2e-33 131 62/91 (68%) homeobox 1 | chr3:182648-184034 REVERSE LENGTH=272

Transcript Sequence (2512 bp)

>PGSC0003DMT400007377 2512 pgsc_dm_v3.4
TCTTCTTACCCTCAAAAAATCTCCCTTCCATATTTTCCTCTATATTTTCTCTTTCTCTAT
GCTGAGTTTTCATCTTCCTTGTCTACTTCTACTTCTTTTTTTCAATATTAATTGTGATCC
TCATTTATAGTACTTATCACAACTTTCTTACTAACAATTCAATAGTCCAATTTTTCACTT
CTTGATTCTCCTCTAAACTCCTAGTACCAAAAAAATTTAGAAGATAGTATGGAGGTAGCA
AGAGTTTATGAAGGTTCTAACAATTGCTTTATACCTCCAAATGAAATTCTTCCTCCTACT
TCTAATTGGGTATCTAACTCTTCCTCCATTTTCCATGGTAAGGTTCCTTCGCCGAAAAAT
TATATTATTTATACATGGTAAAAATTGAGTACTTTTTATGTATGTATAGTAGTTCTCAAC
CCCTTTCAGCTAGTTCGTGTGTTTATTTTTTCATATTTTGAACTGAGTTAGTGAAAATTC
TGATTTCGTCACTGATGTGTGGGGTGATCCTTTGATGATTAAGAGATTATAGCCTAAAGT
TGTAAATATTGACAAGGAAATGATGGAATTTTCTGTTTAATTTAGCTGCCTTGTTATTAT
CCTACTTGTGTTTTTTTTTTCAAGAAAAAAATAACAAATCTTATGTACATATGTAGTTGG
CTTTGTTTTCTCATGTTAATATAAAAAGCTTATTAGCTCAATTGACGGACTATTTGACTA
TCTGAGCTTTCACCTCGTTATTAGTGAATGTTCGATTTTCCACCTCGTGATCTCGTCATG
CATTTGTGAAATTGAAATGAACCAATATTTGTTTCCTTCATTGCTCTGTTTCAGGCTCTG
TATCCATGGTAAATTTCGACCAAGATCAAGTACAAAAGTCTAAAATGAGGTCATTTTTAG
TACAACTTGATCAAGACGATAATAACAGCAACGATGACAATTACAATTATCACCAAAGTG
AAAAGAAGAGACGATTGTTACCAAAGCAAGTTGAGTTTCTTGAGAAAAGTTTCGAGGTAG
AAAACAAGCTTGAACCTGAAAGGAAAGTACAATTAGCTAAAGAAACTGGATTGCAGCCTA
GGCAAGTTGCTATTTGGTTTCAAAATCGACGTGCCCGGTGCAAGACTAAACAACTTGAGA
AGAATTATGATGTCCTTAAAGCTAGCTTTGATAAACTAAAGACTCAATATGATTGTCTCT
TCAAAGAGAATGAGAGCTTGAGAAATGAGGTAAATTTAGTCAAGAAATCATTTATACATT
ATTTGAATATATGATCATATTTCAACTTAATTTTTTGAAAATATTGAGATCATGAGTTAA
AATGATACTTATTAGAAGGGTACAAAGGTAGATTTTGAGAGTAGTTTTTGAAAATTTATG
TTTAGGATATCTGTTTGGCCGTGAAATTTGATCAGACTTTGAAAATGTGATTGGGAGTTC
TACTCACAAAATTCAATTTTGTCCAAGTAAATGCATATCCTAACTCCTAACACAACTTCA
GAAACCACAATTTGTGCGTGTTTGACCATGTTTTAATGATTTTGGTCAAACGTGTCTTTC
AGAGTTCAACTTTGAAAAAAGTGAAAAGATTTCACAACCAAACTTCTTAAATTTCTAAAA
ATCACGAAATTTGATCTAGGTCTTCCCTTTTTTTTCCCTTTTGTGTTCAATAGGTACATT
TACTCAAAGATAAGTTGATCAACAGCGTAAAAGGGAAGGAAACTTCAGAACCTATTAATC
CACTTGATCATGTAGAACCTCAAAATCCTTCTATTGGAGTTGCTTCAAATTTAGCAATGG
TGGTGTGCAAGCAAGAAGATACAAAAAGTGATGTTCTTGATTCAGACAGCCCGCGTTTTA
CTGACGGCGATTACACTTCATTTTTGGAGCCTGCTGATTCTTCAAATGTATTTCAGACAG
AACACTCTGATTTTTCTCAAGAAAATGACACATTATGCTTCCCAAAACTTGAAGAAGATC
ATCATCATGATGATTTACCTGTTAATTCTTGTCATTTGGGTTTTCAAATTGAGGATCAAT
CTTGGTTCTCACATTATTGAGTTTTCACTTCAAGATCATATAAAGGGAAATGAAGCCTTT
GTGCTACATTTCCTTTTTTAATTTACACCAATAATATGTTGTATGTATTGTATAGGTCCA
TTTGGAATGAGATGAAGATCTTTGTTGAACCATTCAGTGTCCACATTGCAGGGTTAATTC
AGGGGTGATGCTCTCAACAGGGTTTTCTCGATACCTCATAAATGATAGATTGATATTTTA
TACACCCTTAACTCTTTTATGGACCAGGTTAAGCTATGTGTTTTACTATAATAACTTAGT
TGAAATCAATGCAAATAATAATAAGAACACAATATTTTTACGTGAAAACATCCAACTCAT
AAGGGTGGAAAAAAATCACGACCTACATCTTTGTAGGATTTCTCCTAATCTTTACTGATT
AATGAGCTTCGACAGAATTTAGATTACCACACTTGCAATCTCGGAACTGACT