Microarray Probes on PGSC0003DMT400006726

Probe IDChipProbe Sequence
CUST_9215_PI426222305 JHI_St_60k_v1 TTTGTATTGGCCACTTAACATCTTATGTGTAATTCTGACCCATTGGGTCAGCACGGGCCA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400006726

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400006726 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G79750.1 +1 0.0 902 479/623 (77%) NADP-malic enzyme 4 | chr1:30007655-30011179 REVERSE LENGTH=646

Transcript Sequence (2239 bp)

>PGSC0003DMT400006726 2239 pgsc_dm_v3.4
CTAGTATTTAACACTCTTTCTCTCTTTTCCCTTTTCTCAACAAAAACAAAATACTCTGTA
TTTCTTCTTCTTCTCTCACAAATCACAATGTTCTCATTGAATGGAACCAATTTTCCGAAC
GATTCGCTATCTGGGGTTTCAAGATGTTTGATTCAGTCCCGGAAAAAGGTGTCTTTTCCT
ATGGTGGTGGCCTCTGTGAGCCCAAATGGAAGACCGGCAGACCGGAATGTGAGTGTTTTA
ATGGAAAATACTTTGAAGGAGATGAAGGAAAATTCTCCAGTTATAGAGAAAGATTCTAAA
TCGACGGTCACTGGTGGAGTCGGCGATGTGTACGGCGAGGATAGTGCCACTGAAGATCAA
ACTATTACTCCTTGGAACTTCTCTGTTGCTAGCGGATACTCATTGTTGCGTAATCCACAC
TACAACAAAGGGTTAGCTTTCAGCGAGAAAGAAAGGGATTCCCACTATTTACGTGGTCTT
CTTCCTCCTGTGGTTTTTAATCATGAGCTTCAGGTTAAGAAATTGATGAACAATCTGCGT
CAGTATGATGTACCACTGCAAAGGTACATGGCCATGATGGATCTTCAGGAGAGAAATGAG
AGGCTATTCTACAAGCTTCTTATGGAAAACGTGGAAGAGCTTCTCCCGGTAGTTTATACT
CCAACAGTAGGTGAAGCATGCCAGAAGTATGGTAGCATCTTCAGACGACCTCAAGGCCTT
TTTATCAGCTTGAAAGAAAAAGGCAAAATTCTTGAGGTATTAAAGAATTGGCCTGAGAAG
AAAATTCAAGTTATTGTTGTAACTGATGGAGAACGAATATTAGGCCTTGGAGACCTAGGT
TGCCAGGGAATGGGGATACCAGTAGGGAAACTCTCTTTATACACCGCTCTTGGAGGCATT
CGGCCGTCATCTTGCTTGCCAGTAACCATTGATGTGGGTACAAACAATGAGAAATTGTTA
AAAGATGAATTTTACATTGGGCTCAGACAAAGAAGAGCTAGAGGACAGGAATATGCTGAA
CTCTTGGATGAATTTATGTCTGCTGTCAAGCAAACTTACGGAGAGAAAGTGCTCATTCAG
TTTGAAGACTTTGCGAATCATAATGCATTTGACCTTCTTGCGAAGTATGGAACTAGCCAC
CTTGTTTTCAATGATGACATTCAGGGGACTGCATCTGTGGTCCTAGCAGGGATCATGGCA
GCACTAAACTTAGTGGGGGGAAACTTGGCACAGCATAAATTTTTATTCCTGGGAGCTGGA
GAGGCTGGTACCGGGATAGCAGAACTCATAGCTCTTGAGATGTCAAAGCAGACTGGAGCC
CCTCTAGAAGAGACACGAAAGAGAACCTGGATGGTGGATTCTAAGGGGTTGATAGTTAGG
TCTCGTATGGAGTCACTTCAACATTTTAAGAGGCCCTGGGCTCATGACCACGAGCCAGTA
AAAGAACTGGTGAATGCTGTGAAGTTAATTAAGCCAACCGTCTTGATTGGGTCTTCTGGC
ACTGGGAAGACGTTTACTAAAGAAGTGGTACAAGCTATGGCAACCTTCAATAAGAAACCA
GTTATTTTTGCTCTCTCCAACCCAACATCACAGTCTGAATGTACTGCTGAAGAGGCTTAT
ACATGGAGTGAAGGGCGGGCCATTTTTGCTAGCGGGAGTCCATTTGCTCCAGTTGAGTAC
AAGGGGAAAGTTTTCGTGTCTGGTCAGGGAAATAATGCATACATCTTCCCTGGTTTGGGT
CTGGGACTTATAATATCTGGTGCTATTCGTGTTCATGATGACATGCTCCTGGCAGCCTCG
GAAGCTTTAGCAGCAGAAGTAAGTCAAGAGAACTTGGAGAAGGGACTAATATACCCACCA
TTTGCCAACATAAGGAAGATTTCAGCTCACATTGCTGCCAAAGTAGCTGCCAAAGCATAT
GAGCTCGGCTTGGCCACTCGTCTACCTCAACCGGAGAACCTAGTAACATATGCTGAGAGT
TGCATGTACAGTCCAAGTTATCGTAGCTATCGCTAAGTCAAGGAAGATACATAAAATTAG
TAGTCATTGATTTTCATAGCTTTGAAGATTAGTGTACTCATGGAGATGGTACTAATTTAG
GAATATATAGATAATTTTTAGTTTTGTATTGGCCACTTAACATCTTATGTGTAATTCTGA
CCCATTGGGTCAGCACGGGCCACTGGTCCTCACTCCTTGTACTGATGTTTAGCTAATATA
AAATAAATAAATTTTACGT