Microarray Probes on PGSC0003DMT400006725

Probe IDChipProbe Sequence
CUST_9540_PI426222305 JHI_St_60k_v1 TTTGTATTGGCCACTTAACATCTTATGTGTAATTCTGACCCATTGGGTCAGCACGGGCCA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400006725

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400006725 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G79750.1 +2 1e-111 343 197/251 (78%) NADP-malic enzyme 4 | chr1:30007655-30011179 REVERSE LENGTH=646

Transcript Sequence (1124 bp)

>PGSC0003DMT400006725 1124 pgsc_dm_v3.4
CAAAGTTGTACTTGGAATTTCTCAACGCCTTCCTCCTTTAAGGCCTTAGCAGTTTAAGAG
CTGGATTTGATCATATATTAGTTTCCCTTCCATTGTATATCTCTGTAGATTTCCGTTATG
CCCCTTAAATCACTTATTGACAATGCAGGCTGGTACCGGGATAGCAGAACTCATAGCTCT
TGAGATGTCAAAGCAGACTGGAGCCCCTCTAGAAGAGACACGAAAGAGAACCTGGATGGT
GGATTCTAAGGGGTTGATAGTTAGGTCTCGTATGGAGTCACTTCAACATTTTAAGAGGCC
CTGGGCTCATGACCACGAGCCAGTAAAAGAACTGGTGAATGCTGTGAAGTTAATTAAGCC
AACCGTCTTGATTGGGTCTTCTGGCACTGGGAAGACGTTTACTAAAGAAGTGGTACAAGC
TATGGCAACCTTCAATAAGAAACCAGTTATTTTTGCTCTCTCCAACCCAACATCACAGTC
TGAATGTACTGCTGAAGAGGCTTATACATGGAGTGAAGGGCGGGCCATTTTTGCTAGCGG
GAGTCCATTTGCTCCAGTTGAGTACAAGGGGAAAGTTTTCGTGTCTGGTCAGGGAAATAA
TGCATACATCTTCCCTGGTTTGGGTCTGGGACTTATAATATCTGGTGCTATTCGTGTTCA
TGATGACATGCTCCTGGCAGCCTCGGAAGCTTTAGCAGCAGAAGTAAGTCAAGAGAACTT
GGAGAAGGGACTAATATACCCACCATTTGCCAACATAAGGAAGATTTCAGCTCACATTGC
TGCCAAAGTAGCTGCCAAAGCATATGAGCTCGGCTTGGCCACTCGTCTACCTCAACCGGA
GAACCTAGTAACATATGCTGAGAGTTGCATGTACAGTCCAAGTTATCGTAGCTATCGCTA
AGTCAAGGAAGATACATAAAATTAGTAGTCATTGATTTTCATAGCTTTGAAGATTAGTGT
ACTCATGGAGATGGTACTAATTTAGGAATATATAGATAATTTTTAGTTTTGTATTGGCCA
CTTAACATCTTATGTGTAATTCTGACCCATTGGGTCAGCACGGGCCACTGGTCCTCACTC
CTTGTACTGATGTTTAGCTAATATAAAATAAATAAATTTTACGT