Microarray Probes on PGSC0003DMT400006654

Probe IDChipProbe Sequence
CUST_9382_PI426222305 JHI_St_60k_v1 GATACTGCAGTTATAACAAAAGAAGCACATTGAGACTGATTCTTGATTAGTCCATGTGTA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400006654

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400006654 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G13750.1 +3 0.0 1367 644/824 (78%) beta galactosidase 1 | chr3:4511192-4515756 FORWARD LENGTH=847

Transcript Sequence (3226 bp)

>PGSC0003DMT400006654 3226 pgsc_dm_v3.4
TCTTCATTTATTCACACTTATTACTCACTCTCATTTACTATAGCTAAAATTCATTATTTT
TTGCATTTTGAAAAAGAAGAAAAATAAAGTTTAAGGGGGGAAAAAAAATTTCATTTTGCC
TAAAAAAGGCACAATCTTGATAAAAAAGGAGATAATTTTACAACATGGGTTGTAAGCTTA
TACTAATGTTGAATGTGTTGTTTGTGTTGTTGGGTTCATGGGTTTTTTCTGGAACAGCTT
CTGTTTCATATGACCATAGGGCTATTATTGTAAATGGACAGAGAAGAATACTTATTTCTG
GTTCTGTTCATTACCCAAGAAGCACTCCTGAGATGTGGCCAGGTATTATTCAAAAGGCTA
AAGAAGGAGGTGTGGATGTGATTCAGACTTATGTTTTCTGGAATGGTCATGAGCCTCAAC
AAGGGAAATATTATTTTGAAGGGAGATATGATTTAGTGAAGTTTATTAAGCTGGTGCACC
AAGCAGGACTTTATGTCCATCTTAGAGTTGGACCTTATGCTTGTGCTGAATGGAATTTTG
GGGGTTTTCCTGTTTGGCTCAAATATGTTCCAGGTATCAGTTTCAGAACAAATAATGGAC
CTTTCAAGGCTGCAATGCAAAAATTCACTACCAAGATTGTCAATATGATGAAAGCGGAAC
GTTTGTATGAAACTCAAGGGGGGCCAATAATTCTATCTCAGATTGAGAATGAATATGGAC
CCATGGAATGGGAACTGGGAGCACCCGGTAAATCTTACGCACAGTGGGCAGCCAAAATGG
CTGTGGGTCTTGACACTGGTGTCCCATGGGTTATGTGCAAGCAAGACGATGCTCCTGATC
CTATTATAAATGCTTGCAATGGCTTCTACTGTGACTACTTTTCTCCAAACAAGGCTTATA
AACCAAAGATATGGACTGAAGCCTGGACTGCATGGTTTACTGGTTTTGGAAATCCAGTTC
CTTACCGTCCTGCTGAGGACTTGGCATTTGCTGTTGCAAAATTTATACAGAAGGGAGGTT
CCTTCATCAATTATTACATGTATCATGGAGGAACAAACTTTGGACGGACTGCTGGTGGTC
CATTTATTGCTACTAGTTATGACTATGATGCACCACTTGATGAATATGGATTATTGCGAC
AACCTAAATGGGGTCACCTGAAAGATCTGCATAGAGCAATAAAGCTTTGTGAACCAGCTT
TAGTCTCTGGAGATCCAGCTGTGACAGCACTTGGACACCAGCAGGAGGCCCATGTTTTTA
GGTCGAAGTCTGGCTCTTGTGCTGCATTCCTTGCAAACTATGACCAACACTCTTTTGCTA
CCGTGTCATTTGCAAACAGGCATTACAACTTGCCACCATGGTCAATCAGCATTCTTCCCG
ACTGCAAGAACACTGTATTTAATACAGCACGGATTGGTGCTCAAAGCGCTCAGATGAAGA
TGACTCCAGTCAGCAGAGGATTGCCCTGGCAGTCATTCAATGAAGAGACATCATCTTATG
AAGACAGTAGTTTTACAGTTGTTGGGCTATTGGAACAGATAAATACAACAAGAGATGTGT
CTGATTATTTGTGGTATTCAACCGATGTCAAGATTGATTCAAGAGAAGAGTTTTTGAGAG
GCGGAAAATGGCCTTGGCTTACGATCATGTCAGCTGGCCATGCATTGCATGTTTTTGTGA
ATGGTCAATTAGCAGGAACTGCATATGGAAGTTTAGAAAAACCAAAACTAAGTTTCAGTA
AAGCTGTAAATCTGAGAGCAGGTGTTAACAAGATTTCTCTGCTGAGCATTGCTGTTGGCC
TTCCGAATATTGGCCCACATTTTGAGACATGGAATGCTGGTGTTCTTGGTCCAGTTTCAC
TCAGTGGTCTTGACGAGGGGAAAAGAGATTTAACATGGCAGAAATGGTCTTACAAGGTTG
GTCTGAAAGGAGAGGCCTTGAGCCTTCATTCACTCAGTGGTAGCTCGTCCGTTGAATGGG
TCGAGGGCTCTTTGGTGGCTCAGAGACAGCCACTCACTTGGTACAAGAGCACTTTCAATG
CTCCAGCTGGAAATGATCCTTTGGCTTTAGACTTGAATACCATGGGCAAAGGACAAGTGT
GGATAAATGGTCAAAGCCTCGGACGCTACTGGCCTGGATATAAAGCATCTGGTAACTGCG
GTGCCTGTAACTATGCAGGCTGGTTTAATGAGAAAAAATGCCTTAGTAACTGTGGAGAGG
CTTCACAACGAATGTATCATGTTCCTCGTTCTTGGCTGTATCCTACTGGAAATTTGTTAG
TTCTATTTGAGGAATCGGGAGGAGAGCCTCATGGAATCTCTTTGGTAAAAAGAGAAGTTG
CAAGTGTTTGTGCAGATATAAACGAATGGCAACCACAGTTGATGAATTGGCAAATGCAAG
CATCTGGTAAAGTTGACAAACCACTGAGGCCTAAAGCTCACCTCTCGTGTGCTTCTGGTC
AGAAGATTACGTCAATCAAATTTGCAAGCTTTGGAACACCACAGGGGGTCTGCGGAAGCT
TCCGTGAAGGAAGCTGCCATGCCTTCCACTCATATGATGCTTTTGAAAGGTATTGCATTG
GGCAAAACTCGTGCTCAGTACCTGTAACACCAGAGATTTTTGGAGGTGATCCATGTCCAC
ATGTTATGAAGAAACTCTCAGTTGAGGTTATTTGCAGTTGATGACACTGAGGATAAACAA
ATAAAGTGGTTTCAGTTAGTTGTCTGAAGATATATATTTGAAGATCCATTACATATAAAA
AAGTTGGCTTTGATGGAGGTGAAGTTGTACAGATATGCAACACACCTTTCCATTTGAGGC
TCATATGAATTGCAATGGCCCAAGATTCTGTATATATTATGTTGGTTACTGTCAAGTTGG
TATTGGTTTGCAAATGTAAAACAATAGTATAGTCATTGGTTCAAGTGCGCATCGAGATTG
TGCTAGTGGGAGGTAGCAGGTTCTGGAGGAATAGTCGAGGTCTGCACAAGCTGGCCTAGA
TACTGCAGTTATAACAAAAGAAGCACATTGAGACTGATTCTTGATTAGTCCATGTGTAAA
TATTGTTACTGTTAGAATTTGCGAGTCTTATGGTTTCAGGATTTTCAGTATTTTAATACT
CTTTATCTTATGTAAAAATAGCAATATTTCATTGCTTTGTACCTGCAAAAATGCTGCTAC
TATGATGATGTGAAATAAACATCAAATTCTCTTCAACAGATGTTTT