Microarray Probes on PGSC0003DMT400006594

Probe IDChipProbe Sequence
CUST_9216_PI426222305 JHI_St_60k_v1 TCGGAAAGATTGTATGTTCAGAAACTCCTGAGGAAGATTGAGAGACAATATATATGAAGA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400006594

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400006594 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G52360.2 +1 8e-132 410 189/306 (62%) Coatomer, beta subunit | chr1:19499420-19505397 FORWARD LENGTH=970

Transcript Sequence (1594 bp)

>PGSC0003DMT400006594 1594 pgsc_dm_v3.4
GAAAAACATTTTTCCAATTCCATTTAGTGTTAAGCTTTTGTTAGTAAGGTTTTAAACTTT
TCAAACGTCCGAGACAATGGTAAGTAATAAGTCATTTTTACATCATCGTGATAATTATAT
ATGTTTATTAAGTAGCATATACAACATACGTATCTTATTTTCAGGATTACTTATTCGTAT
CTCAATGGGACTCATTTTGAATGTCATGACAATATAAAAAGTTCATTACACTAACGGTGT
ATATAACTTAAACTCTATTTTAATGGCTCGTTTGGTCAAATTTTTCAAGAAGCATTTGCA
TTCTCAATATATAACCTTCATAAAACTTGGTCATATAACATCTATATATTGCATCAGTAC
CTGTTGAATTGCAAATATTCAATTTGTATGATCTTATATATCTTGACGACTATTTTTTGT
TGATTGTTCCTTTTCCTTTGTCCTCCGTCTCTGTTGGATCAAATATCGCGGTGTCATCAG
ACTTTTGCAATTGAAATTGAGAAAAAACATGTCCAGAAATCAGAAAGGGTCAAGGCCTTG
GAGATCCACCCAACAGAGCCATGGATTTTAGTGAGCTTGTATACAGGAACTGTACAAATA
TGGAATTACCAATCTCAAACTGTAGAGAAGAACTATCAAGTCTCAGAGTCACCAGTCAGG
TCAGCCAAGTTTATTGCCCGTGAAAAAAGTATTGTTGTTGGATCAGATGATCACTTCATT
AGAGTATACAACTACACAACAGAGGAAAAGACTAAGGAATTCAAAGCACACGACGATTAT
ATCAGATCATTAGCTGTTCATCCTACTCTTCCTTATGTTCTGTCAAGTTCCGATGACATG
ATGATAAAGCTTTGGGACTGGGAAAAAGACTGGGCTTGTACTCAGATTTTTAAGGGGCAT
AACCACTATGTGATGCAAGTGGCCTTCAATCCAAAAGAAAACCAGACGTTTACAAGTGTA
TCACTTGACTGCACAATGAAGATGTGGAATCTTAGCTCCTCTGATCCAATTCTCGAACTA
GAAGCACATTCGAAGGGGATCAATTGTGTTGATTTCTTAACTTGTGATAATAAACAATAT
CTAATCACTGGATCAGATGATCACACAGCTAAGGTCTGGGACTTGCAAAATCAAACTTGT
GTCCAGATTCTTGAAGGTCATAAGAACAATATTTCTGCATTGGCAATGCATCCAGAACTT
CCTGCTCTTTTTACAGGGTCTGAGGATGGAACATTTAGCGTGTGGGATGCTACTAATTAC
AGCTTACTCAACACACAAATCTCTGAACTTGGGAGAATTTGGGCAATTGGATTTGCAAGC
CTGGAAGGTTCTCACATGCTCATAATTGGCTGTGATGAAGGAATGATTATCGGAAAGATT
GTATGTTCAGAAACTCCTGAGGAAGATTGAGAGACAATATATATGAAGAAGCTTATGTTT
TCTTTATGCTTTCTAGTTTCTGCCATTTTAATATGTTTTGATAATTACTTGTACTAGGAT
CTTGTGAATCCATTATGTCTATCTTGTACTTATTTTCTTGGAATTAAAGTTGATGTTGTA
TAAGAAGCCAAGAGTAAATAATTTCTCATAATTC