Microarray Probes on PGSC0003DMT400006444

Probe IDChipProbe Sequence
CUST_9364_PI426222305 JHI_St_60k_v1 CCTCTTTCAATGCTGAATTGATGTGATGTTGGCTTTTCTTTTCCCAATCTACTCCCTCCG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400006444

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400006444 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G25910.2 +1 1e-150 443 219/341 (64%) 3-5 exonuclease domain-containing protein / K homology domain-containing protein / KH domain-containing protein | chr2:11049379-11051997 REVERSE LENGTH=342

Transcript Sequence (1949 bp)

>PGSC0003DMT400006444 1949 pgsc_dm_v3.4
AAACTATTTGAGAATTGACATCATGTAACTTCCAATTTTCCAGTATCAACATAGGTAAAT
GTACGAAACACAGTATAGCATGCATACCCCGCGGCCCCGCCTAAGCAGAAAGAGAGAAAA
GTAGGGCTAAAAGCACTATTCTGCAGGCATTTAGGGTGCTTCGTTTGTGTTGTATCCATT
GAACATTAGCAGTAGTTATGGATATTGAATGTGTAAGGTCCAATGTTAAAAACTGATTGT
TTTGTTGGTGTTCATTTCAAATTTTTCAATCATATGGCTTTAGCATCTAGTCCTCATCAA
ACTTACATTCCTCTCCCATCTTCCAATTCAGGTGGTAGGCATGCTGATCATGAAGTAGTT
TTAAAACCAGTCCCCATTTATATCATCAGCCATGAATCTCAACTTCCAGCCACATTTCTC
AACCCTTCTCCAAAAAATGAGATGGTTGTTGGACTTGACTGCGAGGGTGTTGACCTCTGT
AGATATGGAACTCTCTGTATTGTGCAGCTTGCTTTTCCGGACGCTATCTACTTGGTTGAT
GCAGTACGCGGTGGGAGAAAGTTGATTAACGCTTGTAAGCCTGCTCTTGAGTCTGTTTAT
GTCACAAAAGTTATTCACGACTGCAAACGGGATAGTGAGGCATTATACTATCAGTTTGGT
ATCATGTTGCACAATGTTATGGATACCCAGATAGCTTATTATCTGATAGAGGAACAGTTG
GGGAAGAAGAGCACACAAGATGGCCATATCTCTTTTGTGCGCCTTCTTGCAGATCCACGC
TATTGTGGCATATCATACGTGGAGAAAAAAGAAGTCCGTTCCCTTCTGAAAGAGGATCCT
CAGTTTTGGACCTACCGACCATTATCTGAGCTAATGGTCCGTGCAGCTGCTGATGATGTT
CGATTTCTTCCATACGTATTCCATAAGATGATGGAGAAATTGAGTGAAGAATCATTGTGG
AGACTTGCAGTTCGTGGTTCACTTTGTTGTCGGTGTTTCTGCATAAGTGACAACGAATAT
GCTGATTGGCCAGCAATCCCTTCTATTCCAGAGTTCCTCAATGTGGAAAGAGATACTTTA
GAAGACGAGATCTTGTCCATACTTGATGTGCCACCCGGGAAAATGGGATGTGTTATTGGT
AGAAAAGGATCCTCAATTTTGTCAATCAAGGAATCATGCAAGGCAGAAATCCTAATCAGT
GGATCGAAGGGAGCGCCAGACAAGGTAAGGAAAGCAGAAGCCATGTTGAGGGGCCGGATG
TTGTGACTTGTGAGACAACCCTTTTGCTGCACCTGGAAGCCAAAGCTTTGCATTCGTATT
ACCCGATCATCACACTAAACAAATCTCAAGGGAAACCTATCTCACGTCTTTTTGCTAATA
TACAAACCCTGATCTCCCAAATGCCAATTCATTTCACATTCGACAGGGTTCTAAATCAAT
GCATCTATCGTTGAAATTAAATTCGTACTTGTTTTACACGCCAATTTGAATGTATTTTAG
CGCCTAATACTTCTCTTACGTGGATGGGGTAGACATTGTTCCTTAGGTCAGTTGTGAACT
TGATTGGTGGAGTGGTCTTGGGGGGTCATTGTCATGCCCACGGAGTGGCCAGCTTGGGAA
TTTTGAGAATGATACTGGATAGGAGTGGACTATAAAAATCTAGTTGTAATTGTTGTAGTG
GGAGCCATGGGGGAATAGTTCTAGAAAATGTGGAGAAAGTGACAAAGGGATAAAAGCTAG
CCCCCCCTTCTTCACAGTTCACATGACCACACGGTGACTTTGGGGGATTGCGGACAAAAG
AGGTCGTTGGTGGGCTTAAGGCCATTGAATTTGAAACAGCGTCACTGTACAATGCATGTA
CAGCAAATGTTTCTTCACATACAAAGAAACCTCTTTCAATGCTGAATTGATGTGATGTTG
GCTTTTCTTTTCCCAATCTACTCCCTCCG