Microarray Probes on PGSC0003DMT400006360

Probe IDChipProbe Sequence
CUST_9173_PI426222305 JHI_St_60k_v1 GTCCATAACCTGGCATGGTTGTTTTCTATTTAATGCTTTAAATACCTCAATCCAAAGAGT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400006360

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400006360 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G72830.2 +3 4e-38 141 89/188 (47%) nuclear factor Y, subunit A3 | chr1:27405699-27407088 REVERSE LENGTH=341

Transcript Sequence (1114 bp)

>PGSC0003DMT400006360 1114 pgsc_dm_v3.4
TTTCTTCCGAAAGGATTCTGAGCTGAGTTAGTAACTTAACCCCATTTTGTTAGTGTTAAT
GATCATCACTCAATTCTGTAGATTTACAGATGCAACAAATGTCGACATTTCCTGGTCCTC
AGAATTCCAAGGAATTGAATTATCATTTTCAAGATCAGGATTCCTCGTCTACTCAATCAA
CGAGTCAATCATGTCCTGAAGCTGCTAATGAAGGAGAAAGAAAAAGCCACGGGAAAAGCA
GTATGCCTTTGCGAGCAGGCAGTGTTAGAAGTAGTGGGAAGTCCGATGATTCCCAAAGTG
TGTCAAGTCAGGAGCATGGTTGGACTTTCGATATGTATCAGAAAAATTTTGCTGTTGTTC
CTTTTCCTCATCCGGATCCTTACTATCACGGTCTAGTTGCTGCCTATGGAAATCAAGCCA
TGGTTCAATCCCAAATGTTAGGCATGGTTTCTCCTCGCGTGCCACTTCCGCTCGACCTTA
AGCAAGATGAGCCTATATTTGTCAATGCTAAACAATATCAGGCTATCCTCAGGCGTAGAC
AGTACCGTGCTAGGCTGGAGGCTCAAAACAAACTCTCTAAAGGACGGAAGCCATATCTCC
ATGAGTCCCGGCATCGTCATGCATTGAATAGGGCTAGGGGACCCGGTGGGCGCTTTGTCA
ATATGAAGAAGCCTCGAGAGTCCAAATCCCCTGATTTGATCAATGGTCAAGACAATCAGG
TATCTGATGAGCTGCAACTCAACAGAAAAATGTTGGAGCCCAATATTCATCAATCCAGAA
GCTACTCCACACCAGTATACTCTGGAATCACTAGTGGCTCGAACGGTGATGCTATTTACC
ATCACCAATCATTTAAGTACTCCGCCTTCTCAGCGCGTAACAGAGGGACCTCACAGCTGG
ACAAAGAGAAGAAAGATAACACGAGCAATCCATGTTTATCATCTTTTTGATGCAAGTGTT
GCTATTAAAAGTGGGAAGTCATCCTTGGCTATGTTAGTATTGTAGTACATTATTCTGAAA
ACTTTATAGTTAGTCCATAACCTGGCATGGTTGTTTTCTATTTAATGCTTTAAATACCTC
AATCCAAAGAGTAATTTTTAGTTTATTGTGGCTG