Microarray Probes on PGSC0003DMT400006337

Probe IDChipProbe Sequence
CUST_52714_PI426222305 JHI_St_60k_v1 CCCTCTTTTGAGTGACATGTTGATCAATGTTCTTTTTTCTTGGTTGATTGGTCAAATTTC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400006337

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400006337 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G29320.1 +1 1e-86 276 140/193 (73%) Glycosyl transferase, family 35 | chr3:11252871-11257587 FORWARD LENGTH=962

Transcript Sequence (585 bp)

>PGSC0003DMT400006337 585 pgsc_dm_v3.4
ATGGAGGCCAGTGGAACCAGTAATATGAAGTTTGCAATGAATGGTTGTATCCAAATTGGT
ACATTGGATGGCGCTAATGTTGAAATAAGGGAAGAGGTTGGAGAAGAAAACTTCTTTCTC
TTTGGTGCTCAAGCTCATGAAATTGCAGGGCTTAGAAAAGAAAGAGCTGACGGAAAGGTG
AAGCTCACCCCTCTTTTGAGTGACATGTTGATCAATGTTCTTTTTTCTTGGTTGATTGGT
CAAATTTCGTCTTTTATTTCCTTACCATTTGTACCTGATGAACGTTTTGAAGAGGTGAAG
GAATTTGTTAGAAGCGGTGCTTTTGGCTCTTATAACTATGATGACCTAATTGGATCGTTG
GAAGGAAATGAAGGTTTTGGCCGTGCTGACTATTTCCTTGTGGGCAAGGACTTCCCCAGT
TACATAGAATGCCAAGAGAAAGTTGATGAGGCATATCGCGACCAGAAAAGGTGGACAACG
ATGTCAATCTTGAATACAGCGGGATCGTACAAGTTCAGCAGTGACAGAACAATCCATGAA
TATGCCAAAGACATTTGGAACATTGAAGCTGTGGAAATAGCATAA