Microarray Probes on PGSC0003DMT400006026

Probe IDChipProbe Sequence
CUST_51249_PI426222305 JHI_St_60k_v1 CTTATTAGTAGCTAGTCAACAAGAACAACCGTCAGACGTCTCAGCCCAAAATTTCCTATT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400006026

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400006026 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G26300.1 +3 1e-77 226 121/292 (41%) cytochrome P450, family 71, subfamily B, polypeptide 34 | chr3:9639199-9640866 REVERSE LENGTH=500

Transcript Sequence (1266 bp)

>PGSC0003DMT400006026 1266 pgsc_dm_v3.4
ACAAGTACTAAAAACTCATGATCTCGCTTTTGCATCTAGGCCTAAACTTGTAGCCACCGA
TATTATTTGTTATAATGGGAGCGATATTGTTTTTTCTCCCTATGGTGAATACTGGAGACA
AATGCGTAAACTTTGCATTATGGAATTGCTTAGTGCCAAAAATGTCAAGTCATTCAGTTC
TATTAGGCAAGATGAAGTTCTTCGTATGATTCAATTTTTTCAATCATCTTCTGGTGAGAC
AGTTAATGTCACTGAAAAGATTTTTCAATTCGCGAGCTCTATGACTTGTAGATCAGCATT
TGGGAAAGTATTCAAGGAAAAAGATGAATTTATACAAGTGGTACAAAAAAGTGTCACATA
TAATGGAAGGATTTGATGTGGCTGATCTTTTCCCATCATTGAAATTTCTTCATGTGTTAT
GTGGAATGAAGAGTAGAATTATGGATGTCCACCATGAATTAGATGTCATTCTTGAAAAAA
TCATCAATGAGCACAAGAACAATGATGAATTAGGAGGTGAAGGTTTAGTTGCTGCATTGA
TTAAAGTAATGAAAGAGGGAGGCCTTCAATTTCCAATCCCCAATGATAACATCAAAGCTA
TTATCTTTGACATATTTGCCGCGGGGACAGAAACTTCATCAGCAACAATTGATTGGACCA
TGGTGGAAATGATGAGGCATCCAAATGTACTCTCCAAAGCTCAAGAAGAGGTAAGAAACA
CCTTTAAAGGTAAAGAAACTTTTGATGAAAATGATGTCGAAGAATTGAAATACTTAAAGT
TGGTCGTTAAAGAAAGCTTCAGACTCCATCCTCCATTTCCCCTCTTGCTTCCAAGAGAAT
GTAGGGAAGAAGTAGACATAAATGGATACAATATTCCTTTGAAAACAAAAGTTATGGTTA
ATGCATGGGCTATTGAAAGAGATCCTAAATATTGGAATGACGCAGAAAGCTTCAAACCTG
GAAGATTTGAGGACAACTCTATGGATTTTGTTGGTCATAATTTTGAGTATCTTCCCTTCG
GTAGTGGAAGAAGGAATTGCCCTGGGATATCATTTGGCTTAGCTAATGTTTATTTTCCAC
TGGCTCAATTGTTGTATCACTTTGATTGGAAACTTCCTAATGGAATCAATCCAAGTGAAT
TGGACTTAACTGAATCTGCTGGATCAACTTGTGCTAGAAAGAGTAATCTTTACTTGATCG
CCACTCCTTATTAGTAGCTAGTCAACAAGAACAACCGTCAGACGTCTCAGCCCAAAATTT
CCTATT