Microarray Probes on PGSC0003DMT400005271

Probe IDChipProbe Sequence
CUST_18572_PI426222305 JHI_St_60k_v1 GGGATTCTCTCATACTCCTGGTTTTCCTCTAGTTTCATTATATGTAGATATTGGTATTCT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400005271

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400005271 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G04900.1 +2 2e-23 97 62/121 (51%) ROP-interactive CRIB motif-containing protein 10 | chr4:2486218-2487779 REVERSE LENGTH=156

Transcript Sequence (1421 bp)

>PGSC0003DMT400005271 1421 pgsc_dm_v3.4
TATGAATTACACCCCAGCCCCAAATCCCCCTTTTGTAGTCTGTATGTTCTTTGTAAACTA
ACCTCAACCCCTTTCTTTTTTGTGAGGTTTTCGTGGTTGTCCACCTCTAACTTTCTCTCT
TTCCCCTAGTTCTTCTTCTTCAACTCTCCATTTTTGTATCATTTGCCACTTTTCTCTTTC
TTTCCCTTTTCATTTCTCGCATTTTCCCTCTTTGGCCTTTTTTTCTTGATTTCAAACTAT
TGTTTTTTGCATGGTTGGTTTCTTGGTTATTACATTTTTATTATGCCTAGATTACTTGAA
GAAAGATGATGGGCAATGCAGCAGTAAGTTGAGGAGAAGGAATACCCCTTTCTTTTCTAT
CAGATTTTATCAAGAAAGGCAAAGGAATTGGTTCTTCACATTTAAGTGCTGCTGCTGCTG
CTGCTTCTATCTGTATTCTGTTTCATCTCTGAGCAGAGGGTGTTTGTTGTATTGGGGTTT
TACATACTCTTCTATGGGAACCAAAATGAAGGGGATCTACAAATACATTTCTAATATTTT
TGTTGTGAAGGAGAGGGAGATAGAAATTGGATTTCCAACTGATGTTAAGCATGTGGCACA
TATTGGTTGGGATGGACAATCAGGCAATGCACCTAGTTGGATGAATGAATTCAAGACTGG
GCCTGATTTTGCAGCAACTTCTATTGGTAATTCTGGTTCTGCACATTCTCCATGGGCATC
ACAAGATTACACAGAGTCATTGAGACAGCAACAATCATCTGATCTTTACAGGGACGTAAC
ACCTACAGTGGGTCCTAAGAAACAAAAGCGGAGGAAGGCCAAGTCGACATCCTCTCCTAG
GTCTGGTTCATCATCCTCGTCAAGGTCATCACGAGCAGAAAAATCCAAGACTAAATTTGT
CGAAGGCAATGCTAAACCACTAAACATAGAGGTGGCTTAATGGTACAAACTTGTAGCTTA
AACTGCTGAGAATTCTGTCATTGCCTAGCTATCAAAGTTGTTCATAGTCCTCATGGAAGG
ATCCACGAGAAAGATGAGGAGGGTATAGAAACTTGAGTAGATGTAGAGAGTGTTACACTA
CAAATGTTATAAAGTAATATGGAAGAAACCTAAAGAAGTAGTAGGAGGGCTTAGAGATGT
GAAAACACAAGGTGAAAAACTTGAAAACTTCCAAAACCAGGACAATGTTTTGGGAGAATT
ATAAATTCTTTTCCTTTATTTCTTCTATTTATTTTTCTCTTAGTTTTATCGTTCCTCTTC
TTGTAACTACAACGAGGAAGGATCGTGTAAAGAGTTGAATCGTTTAGTCTATTGGTTGAA
GATTGTACTAATGCTAATTATTTGATTTGAACAATCTCCAGGGATTCTCTCATACTCCTG
GTTTTCCTCTAGTTTCATTATATGTAGATATTGGTATTCTT