Microarray Probes on PGSC0003DMT400005265

Probe IDChipProbe Sequence
CUST_18496_PI426222305 JHI_St_60k_v1 ATCCCAACTGTTGAAGGAAGCTTCTTCGTGCAGAATGACATATTTCGCCTCAACTATGGC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400005265

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400005265 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G11570.2 +1 5e-57 176 85/123 (69%) NTF2-like | chr1:3883280-3883956 FORWARD LENGTH=132

Transcript Sequence (378 bp)

>PGSC0003DMT400005265 378 pgsc_dm_v3.4
ATGGAAGAACAAACAGAAATAGTAGGAAGGGCATTTGTGGATCACTACTACAATCTTTTC
GACAATGATCGATCATCAATTGGTACTCTGTATCAACCAAGCTCCATGTTCTCATTTGAG
GGCCAAAAGTTGCTCGGAAATGAAGATATCTCTGCTAAGCTTAATGCCTTGCCTTTTGGA
CAATGCCGCCATGTGATTAGCACCATTGATTCTCAACCTTCGTCCTTTGCTGGAGGGATC
ATAGTCTTTGTCAGTGGTAGCATTCAACTACTTGGAGAGGACCATCCACTGAGGTTTAGT
CAGATGTTTCACTTGATCCCAACTGTTGAAGGAAGCTTCTTCGTGCAGAATGACATATTT
CGCCTCAACTATGGCTAA