Microarray Probes on PGSC0003DMT400005245

Probe IDChipProbe Sequence
CUST_41061_PI426222305 JHI_St_60k_v1 GGGCTCATAACAGTTATGCATTTATCTATTTTTAGGAATGTATAGCCCGTGTACAACATA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400005245

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400005245 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G01280.1 +2 1e-137 404 199/276 (72%) voltage dependent anion channel 1 | chr3:85754-87612 FORWARD LENGTH=276

Transcript Sequence (1718 bp)

>PGSC0003DMT400005245 1718 pgsc_dm_v3.4
GGCTTCTGTTGCTTTTATATACTCTGCACTCTACTTCTACATATTGTTTTCTTCTCCATA
GCTGCAGAGCTTTTGTCTCCATTTCTTCTTCTTCTTCTCTGTGATATTCGATTCAATCAT
GGGAAAAGGACCTGGTCTCTACTCCGATATCGGCAAGAAGACCCGAGATCTTCTGTACAG
GGATTACCAGACTGACCACAAATTCACAATTACGACCTACTCTCCTACCGGAGTTGCTAT
TACTTCATCTGGATTGAAGAAAGGTGATCTATTTCTGGCTGATGTTAACACTCAGTTGAA
GAACAAGAATATCACAACTGATATAAAAGTAGACACGAACTCAAATCTTTTGGCAACTGT
TACTGTCGATGAAGCTGCTCCTGGGCTGAAGACAATTTTTAGTTGCCGAATTCCTGATCA
AAGTTCTGCAAAGATGGAACTTCAATATTTACATGACTATGCTGGGATATGCACCAGCGT
TGGGTTGACAGCAAATCCCATTGTCAACTTCTCTGGTGTCTTGGGAACCAATGTTCTTGC
TCTAGGAACTGATGTATCCTTTGACACCAAGGCAGGAGCTATCACAAAGTGCAATGCAGG
CTTGAGTTTCACAAATGCCGACCTCATTACTTCCTTGAATCTTAATAACAAGGGAGATTC
TTTGAGTGCATCATACTACCACATAGTCACCCCCCTGACTAGTACTGCTGTTGGTGCGGA
GGTGACCCATAGCTTCTCTACCAGTGAGAACACCATCACTGTTGGAACTCAGCATCAATT
GGATCCCTTGACGACTGTTAAGGCAAGGGTTAACAACTTTGGCACGGCAACTGCTCTGAT
CCAGCATGAGTGGCGTCCAAAGTCTCTTTTCACCATTTCAGGAGAGGTGGACACCAAAGC
TGTTGACAAAAGTGCCAAATTTGGACTAGCCTTGGCTCTTAAGCCATAGGCATAGTCAGA
GGTTTAGGACAATCACCCGTAGACAATGGACTATTGAGCAAATTAGAAGACTTGTTTCTG
TGGCAATTTATCTGGTAGTTCTGGACTGAAAAAATAATTTTAGGTGGTTGTTTCAACCAA
CGTCGTGTCATTCTGACATCGTACATTCTTATTCTCAACTCTTTTTGACAACTCTTTTTG
AAACTGATGATGGGTAAGTTGGGTACCTCATTATACCCATAGACTCGAGGCTTGAGAGTT
TTTTGCTCGAGATTTTTGTCCAAGTAAAAGCGCATTGTTGAAGAATCATTATCCATAATA
TGTTTTCTACTTGGCATGTTCCAAAATTTATCCTTAATTCGTTGGATTTAGTTTGCATTC
ATCTACTTAATTTTATGATAATTGCAGTGGGAAAATTGTTCTTATTTGCTTGCTGTGTTT
GGGTATGCCATGATATCTTGCAAGTTGTTAGCTGGTCTGCTGTTTAAATTGTTGGGGACT
GCTGTGGGTTTGTTGCTGATGGCTGAGGCAATATTGGTGGCCAGAGATTGAAAATTAATT
TGCTCTATAGCCCATGTGTATCAGGCTTTTGTCTTCGCTTCACTACTTTATGAGCAGGCT
GCGTCAAGATAATCAAGGAAACCAGGGTGACTTGGCTTAGAACAGTTGTGCATTTATATA
TTTTAAAGAATGTATAGCGTGGGTGATAATCCTATAGGGCTCATAACAGTTATGCATTTA
TCTATTTTTAGGAATGTATAGCCCGTGTACAACATAAT