Microarray Probes on PGSC0003DMT400004892

Probe IDChipProbe Sequence
CUST_43712_PI426222305 JHI_St_60k_v1 TCTACCTTACCACTTCTTGCTCAGGCAAAACCAAGATTAGCTAAGGTCATGTATCTTTAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400004892

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400004892 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G05260.1 +1 1e-85 270 154/289 (53%) cytochrome p450 79a2 | chr5:1559778-1561765 REVERSE LENGTH=523

Transcript Sequence (948 bp)

>PGSC0003DMT400004892 948 pgsc_dm_v3.4
ATGGAGGAAATGAATACTGAAATCGCTTTCATTCGTCTTGGTAATTATCATGTAATTCCT
GTAACTTCTCCTGAACTTGCTTATTACTTACCATGGTTAAGTGTTTTTGATTTGGATGGT
CACAAGGCAATTATCAAGAAAGCCTATGCTACAGCAACAAAACATATAGATATTGAAGTT
GATCATAGGATACAAACATGGAAAGATGGCAACAAATCTTTGGAAGAGGATATTCTTGAT
GTTCTTATCATGCTCAAAGATACAAATGGAAATCCATTGATGAATGTTAAAGAGATTAAG
GCACAAGTGCTAGAATTCTTTATGGCAACGGTAGATAATCCCTCAAATGCAGTTGAATGG
GTACTTGCAGAAATGTTGAATCAACCAATTTTAATGCAAAAGGCTATAGAAGAACTCAAC
ATTGTTGTTGGGATCAATAGATGGGTTCAAGAATCAGACTTGCCAAGGCTTAATTATGTC
AAGGCTTGCATAAAAGAGGCCTTTCGACTCCATCCCTTTATGGCTTTTAATGTTCCTCAC
GTGTCTGTCTCTGATACCATCGTCGGTGAAAAGTACTTCATCCCTAAAGGGAGTATAGTG
CTATTAAGTCGTCTTGGACTTGGCCGGAATTCTAGAGTTTGGGAGGATCCATTAAAGTTC
AAGCCGGAGCGTCACCTCGGAATGGAAGATGGTGGTGAAGTAGTTCTCACTGATTTAAAT
TTACGTTTGTTATCATTTAGTATTGGAAGACGAGGTTGTCCAGCTGTGAAACTTGGTTCA
ACAATTACTACAATGTTACTTGCTAGGCTTCTTCAAGGATTTACTTGGAATTTACCACCA
AATTCACCATGCAATGATTTAATTGAGTCATCTAAGATTAATCATTTTTCTACCTTACCA
CTTCTTGCTCAGGCAAAACCAAGATTAGCTAAGGTCATGTATCTTTAA