Microarray Probes on PGSC0003DMT400004888

Probe IDChipProbe Sequence
CUST_43683_PI426222305 JHI_St_60k_v1 TTTGGATGGTCACAAAGCAATTATCAAGAAAGCCTATGCTACAGCAACAAAACATATTGA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400004888

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400004888 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G05260.1 +1 3e-50 173 97/217 (45%) cytochrome p450 79a2 | chr5:1559778-1561765 REVERSE LENGTH=523

Transcript Sequence (681 bp)

>PGSC0003DMT400004888 681 pgsc_dm_v3.4
ATGGAGGAAATGGATACTGAAATTGCTTGCATTCGTCTTGGTAATGTTCATGTCATTCCT
GTAACTTCTCCTGAGCTTGCTTGCGAGTTCTTGAAGATCCAGGACTCTGTTTTCTCATCC
AGGCCTATTTGTATGTCCGCGAGCCTTATTAGCAATAGCTATATAACTTCTATTTTCCTC
CCCATTGGTGATCAATGGATGAAAATGAGGGGAATTCTTGCTTCTCATGTGCTATCACCA
ACATCATTTCAATGGCTTCGTTGTAAAAGGGATGAAGAGGTTGACAACCTTCATCGATTC
GTTTACAATAATCAATCTACTAGTATTAATTTGAGGAAAGTGACAAGATGTTATTGTGGA
AATGTAATTAGGAATATGATTTTCAGCAAGAAATCCGCTTTATTTGAAACTATAGAAGAA
GTTGATGCACTTTTTACACTTCTTGAATATCTTCATTCTTTTGGTATATCAGATTACTTA
CCATGGTTAAGTGTATTTGATTTGGATGGTCACAAAGCAATTATCAAGAAAGCCTATGCT
ACAGCAACAAAACATATTGATATTGAAGTTGATCATAGGATACAAATATGGAAAGATGGC
AACAAAACTTTGAAACAAGACATTCTTGATATTCTTATCATGCTCAAAGATATCAATGGA
AAATCCATTGATGAATGTTAA