Microarray Probes on PGSC0003DMT400004872

Probe IDChipProbe Sequence
CUST_43713_PI426222305 JHI_St_60k_v1 GCCGTCCAGTACGTCTGCAAATAACAAAGTCCTTCTAGGAATTGGTGGAGGACATTATGT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400004872

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400004872 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G03800.1 +2 2e-46 159 74/116 (64%) D-aminoacyl-tRNA deacylases | chr2:1156782-1158695 FORWARD LENGTH=317

Transcript Sequence (697 bp)

>PGSC0003DMT400004872 697 pgsc_dm_v3.4
AAATTGACTAGTCATTTCGTTGCCGTCCAGTACGTCTGCAAATAACAAAGTCCTTCTAGG
AATTGGTGGAGGACATTATGTGCCACGACATACAGATGTGATAAAGAAGGATGGTTGTTG
GGTGGGCCAACTCCTCTCTGGTTACTCCTTACCGATGGAAGATCCTGGTCCATCAAAAGG
TAAAGTAAATGCACAAGATATTGCTGGAACTTGGAAACACTCGATTAGAGCAGCATATGA
TGCTACTAAAGCAGGTTTTCCTGGTGGAGAAATTCTGGCACATCTTGATCAGAAGAGTTT
CAAGAGCTGGCAGAAGAACGCGATCATTGAATTCCTAGGTGCACAGAACATTAAAATTGG
CAAGCCAGGTGACTTCCGCTGATTCTGAACATTTTAAGCAAGTTACTTATTACTGGTGAA
GTTGTTAAAGGTCAACAACTTCCATACGTTTTTTGTGATTAGATGTAATTGTAGAGTAGG
TTGAAGCAATATCGATTTCAAAAGATATTACATAAAAAGAAATTTTAATTTTATATATTT
AGTGTAATTTTTCAAAGAAAGTTCAGATGAATCCCTTGTCCCGATCTATCTAGTACTTTC
ATGCATTGTGTTTTACATTGACAACGACAATAATCTTGAAGTCATAAATTAGATGATGTA
ATCTACATTTTTACATACTGATAACAATGTTTCTCCA