Microarray Probes on PGSC0003DMT400004866

Probe IDChipProbe Sequence
CUST_43690_PI426222305 JHI_St_60k_v1 ATTTAAGTTTGGGCTAGTTAATGACTCAGTACCCATCTAAGATTTGGGCTTGAAATTATC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400004866

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400004866 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G14620.1 +2 2e-166 509 256/411 (62%) domains rearranged methyltransferase 2 | chr5:4715429-4718578 REVERSE LENGTH=626

Transcript Sequence (3407 bp)

>PGSC0003DMT400004866 3407 pgsc_dm_v3.4
GTCCTTACATGTTTGGTTATCCTCATAAGTCCTCTCTTTCTTCTTTCGCTTAATTTGTGA
AAAAAACTGATTTTTTCATCACTTTCTACACTTTACTCTGAAAAAAATGCATATAGTAGC
GATATAATTCGTCTATTAGGTAGTTAAATATATCTCGACAACTAAATTTTGGGTGATGAT
TTATTCTTGTCGCTGAAGAGTTCGGAGTTCTTTTTGAGGAATTACCTTTAAAAATGGATA
ACAACTTTTCTGGAGAAGACAATGACAACATTGACTGGGATACTGAAGATGAATTAGAAA
TACAAGAAATACCGGACGCAACATTTTCCTCGTGCACAAATTTAAGAAATGTTGGACATC
ATACTGTTAGTGGTCATGGGGAGGTATATGCTTTAATCCTTGTATTCGATATCTAGTGAT
ATTTGTTGTCGAGGAACATTGCATCTCAATTTATGGCCTCTTTTGGTCTTCTCGTACGTG
AAGGCAAGCTCATCATCAGTACCCTGTCAATCCAAGTTCATTCAACAATTTATTGTGATG
GGATTTCCTGAAGAATCTATTGCAAAAGCGATAGAGCAAAATGGTATTTCAATTGCCCGA
GTCTTTATACAACTAAAAAAATGATTTTTCAATTGTCGTATTGATGTTGTTGGACTTGAG
ACACAGGAGAAAATGAAGGTTTGGTGCTAGATGCTCTTTTGACATTCAAGGTGTGTAAAA
TCTGCCTCATTGTTTGCCAACCACCTTTTTCTCTACTTATAGCTGCCTATACGTTCCGCC
ACTTGCATAAGGTTTTCTTAGATCAGTCAGCGGTTTAAATGGACGGCTATTAACCGATGA
CGATATTCTGTCATTTGAACGTTTCCCTAGGTGGTGACTGTGCAATGTATGATGCCAATT
GTGTTAGAATATACTGAACTTTTATCTGTCTTCATTGTAATGATGACTTTCTTCTATCGT
TTCATTTTTCACTAGAATAGAAGAGGAAACAAAAATAGAAAAATTATGATCTTTATTTGC
ATAAACTTTAGTACCACGAATCGTACTTTTTGTTTGTCTTTGGATGTAGCAGGCACTTGA
AGATTCTCCTGAAGAACAGCCTAGTACGAGTGCACAGATGGAACCCAGCATTAGTTCTGA
TGATAGCTCTTCTCAATGCAACGAGAACGTTTTGGATGATGTTTATGAAGATGATAGTTG
GTCCTCGGACTCGGACAATTGTATGGTATGTTATCCTCAATCATTACTCTCCATTGTACT
TTTCACTGTCTAGTCGTGGCGTAGAAATAGTCAATCTGGTTTGTCTTTTTTTCAAAAATA
TACATCTAGTCATTTTATTCCGCGCATCTGTTCATCAACTAATTAATACTTCTTTTACCA
TTAAGGATGTTTGCTGGTCCTGAATCCTGTTATGAGTTTTCTAACATTTTCTGTCATTTT
CCGTGTACTATGTGTGATAGAATTCTGCTAAACAGACTTACTTGAATGACGACAACAGTT
CTTTGTCTGAAAACGAGAATTCATTATTATTCCTAGCAAATATGGGATACCCCGCGGAGG
AGGCTTCCATAGCGATGGAGAGATGTGGTTCGTATAATTTTTTATATGTTTTGTCCTCTG
TTGTATCTAGGACAAAATCTGCTTATTAACTCTGCAATATACCTAAATATCTTTTTGGAA
TCGCGATATCTATTTTTGATTTCATTTCCAGATTATTAAATGTCTTCTTCACAACTTTCT
AGGTCCAGAAGCATCGTTTTCGGAGTTGATAGATTTCATGTGTGCTGCTCAAATGGCAAG
AGAAGAAGACGTCTATCTGCCCGAAGATGAAAAGCCAAAACTAAATAGTGGTGGATACAA
GAGGAAGATGTATAATGAACTTCCCGTAAGGAAAAAGCAAAGGGCGATTACAGATGAAGA
GCCAATTCATTTGCCCAGACCTATGATCGGATTCGGGGTTCCTACGGAATCCTTACCAGC
TATAGTGCAAAGAACTCTGCCAGAGCAAGCTATTGGCCCCCCTTTTTTCTATTATGAAAA
TGTTGCTCTTGCTCCAAAGGGTGTGTGGGACACCATGTCAAGATTCCTTTACGATGTTGA
GCCCGAGTTTGTTGACTCGAAATATTTTTGCGCTACCGCAAGGAAAAGGGGATATATTCA
TAATCTACCAATTGAAGATAGATTTCCTTTACTTCCACTTCCTCCACGTACCATTCATGA
GGCGTTTCCTCTAACGAAGAAATGGTGGCCATCTTGGGATACACGAACAAAGTTAAATTG
TTTGCAAACATCTATTGGGAGTGCAAGGTTAGCTGATAGAATCAGGAAAGCTATGAAAGC
GATGGAGAACTTCGATGGTGAGCCACCGTTGATGGTGCAAAAGTATGTTCTAGATGAATG
TCGGAAGTGGAATTTGCTGTGGGTTGGTAGAAACAAAGCTTCTCCTCTGGAGACTGATGA
ATTTGAAATGCTAATGGGATTTCCACGGAATCATACCCGTGGAGGCGGTATAAGTAGGAC
CGATAGATACAAGTCGCTTGGTAACGCGTTCCAGGTCGACACAGTGGCATACCATTTATC
GGTGTTGAAAGACTTGTATCCAAATGGTATCAATGTTTTATCACTATTTTCTGGAATTGG
TGGTGCTGAAGTTGCTCTATATCGTCTCGGTATTCCATTGAACAATGTGGTTTCCGTAGA
GATATCTGAAGTGAACAGGAATATTCTGAGAAGCTGGTGGGAGCAAACAAATCAAAAGGG
GAATCTTATAGATTTCAATGATATACAGCAGCTGAACGGAGACGTCTTGGAGCAAATGAT
CGATTCATTTGGAGGATTCGATTTAGTAATTGGAGGAAGCCCGTGCAACAACCTTACTGG
AAGTAACAGAGTGACTCGAGATGGACTCGAAGGTAAAGATTCTTCTCTATTTTATGACTA
TGTTCGGATAGTGGACTTGGTCAAATCCATAATGTCTAATCGTAGAGTGTGACGAAAATA
TGTTTGAGTTTCTGAAGGGGATGGACTTGGAAGGCAACGAGTAAAATGTTGTCTTTGATT
TTGATTTTGGTTTGTACATATTTTTCGATGCAGTATGTTCGTTCGTGGAAAAATGAACTG
TTGAACTTCTCATTGTAAATGACATCAAATGACGTTGAAAATGGGTAGTCTTGAACTTTG
TGATTCGTGCTGAGCTCATGAGCAAACGCCAAAAGTGTTGTCCATGGAGCGAAAACTTAT
TAAATTTGAATTTTGTTCATGGGGTAAAAAGTTCAAAACCATCTATTTTGAATGTCATTC
CTCTAAATCACTCAAATTAGTCCGTGAAATTATAATTCGTCCAATCCATTTAAGTTTGGG
CTAGTTAATGACTCAGTACCCATCTAAGATTTGGGCTTGAAATTATC