Microarray Probes on PGSC0003DMT400004809

Probe IDChipProbe Sequence
CUST_43695_PI426222305 JHI_St_60k_v1 GGTCTTAGGTGATTATAGTACCAAGTTGATACTATCTTTGTCAATGTCACTCATGGTTTT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400004809

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400004809 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G70000.1 +1 5e-49 169 112/210 (53%) myb-like transcription factor family protein | chr1:26363674-26364635 REVERSE LENGTH=261

Transcript Sequence (1236 bp)

>PGSC0003DMT400004809 1236 pgsc_dm_v3.4
TTTTTATTTTTTTTTCTCATTTCCTTCATTTTACCATATGGTTTGCGCCAACAAATAAAT
CATTCAATTTTTCCTCACAAAATATCAAATTGCCTAGCCACCATGTCTAATAACGATCAG
TTCTTCGTCCAAAGTGGAAACAAAGAGCATGAACCCCGAACGTTCGCGAAGGGGTTCATG
CTTTTTGGTGTTAGAATGATGGAAGGTGCTGCTGCTACTGGTGGTTCATTTAGGAAAAGT
GCTAGTATGAACAATCTAGCTTTATTGGATACCGAGCAGCAGCATCAAGATCATTCTAAC
ACCGATTATGCTTCTGATGACGTTGTTCATCCTTCAGCTAGGAGTCGTGAACGTAAACGA
GGTGTACCATGGACAGAAGAAGAGCACAAACTATTCTTGGTAGGATTACAGAAAGTAGGA
AAAGGTGATTGGAGAGGAATTTCTAGAAACTTCGTCAAAACAAGAACTCCAACTCAAGTA
GCCAGTCATGCTCAAAAGTACTTCCTCCGGCGTAACAACAGTAATCGTAGACGCCGGAGG
TCTAGTCTTTTCGACATCACCACTGATGATACTGTTCAGGGTGCTGCTAAATTGGAAGAT
AATAAGCAAATGATTGATTGCCGGATGTCAGCTTTCCGGTTCGAGCCGCCGGTGAAGTTA
CCGGTCACCGGAGAAAGTTCGTCGGAGAATTTTACGATAGGAATGAACAAATCCATGAAG
CCTATTATGCCAATACCAGCTCTTCCTGTCCCTCCTTCATCAAAAATGGCAGATCTCAAT
TTAAATCTGTCCACGTCAGCATCGGTGGCGGCGGCAAGTGAAAAATCGTCGCCGCCATCG
AGGCATTCGCCGGCTTTCCAGCCCGCGATGTCTGGTGGCTTCAGTGGTAGTACTAGTGGG
GATAGTATAATTAGTGTGGCTTGAAGAATAATGATTGTTGTTATTAGTTAATTTAAGATA
CATGTGATGTAATTAAGTGGGGTTTAATTATTAGTTAGAGAAGATTGGATATTAATTAGT
GGGATTAGATTATTGGAGAAAATATTAATTAGGTGATTGATGATGATGATTGCTTTTGTT
TTGTTGTATAGATATGGTGTTGTTTTCATTAGTTGTGATGATTTTGTTGCTTAGTTAATT
ATGTCTTTGCTTTATTTTTGTGGTCTTAGGTGATTATAGTACCAAGTTGATACTATCTTT
GTCAATGTCACTCATGGTTTTATTATAAAATGTAAT