Microarray Probes on PGSC0003DMT400004251

Probe IDChipProbe Sequence
CUST_28078_PI426222305 JHI_St_60k_v1 GAGCAAGAGAAACTACTGTTGTTACTTGTGCTGTCAATAAATATTGCAATCATGCTATTC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400004251

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400004251 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G24910.1 +2 2e-146 439 235/538 (44%) cytochrome P450, family 714, subfamily A, polypeptide 1 | chr5:8567674-8570260 REVERSE LENGTH=532

Transcript Sequence (1940 bp)

>PGSC0003DMT400004251 1940 pgsc_dm_v3.4
AGCATGTCAATGTACCACACCTTGCCATTTTTGTCATATTTTATTCAATGGAAAGAGAAT
CAGAAATAATAAAATCTTAAGCCCCTCAACTCAAATATTTAACACCTTTTATCCATTTAT
AAGTAGATTCTATCAACTGGTCAACATACAGTTTTAGAGGAATTTTAAAATGGAAACAGA
ACAATTACTGATAATTTCATCACTAGTTTTATGTGGATCTCTGGGGTTGTTCTTTGCACA
TGTCACCAATTTTTTACTTTTACATCCAAGAAAATTGAGATCAAAACTTCAAAGCCAAGG
GATTAAGGGACCTTCTTCACCATCTTTTCTCTATGGAAATATCAAGAAACAGGCAACCCC
AGAAGAAACCAACAATCAAGAATTACAAGAAAACAAACATACATGGCCTTCCAGAGTGTT
TTCACATATAAAACAGTGGCAAATTGAATATGGATCAATATTCATGTATTCATCTGGAAC
CATACAGATACTATGTGTAACTGATGCAGATATGGTGAAAGAGATATCTTTGAACCTGGG
AAAACCATCTTACTTATCCAAAGATCATGGTCCTCTTCTAGGCCAAGGCATTTTCTCTTC
AAATGGCCCTTACTGGGCTCATCAGAGAAAGATCATTGCCCCTGAATTCTATCTCAACAA
GGTTAAGGAAATGGTGAAACTGATGGTTGAATCCACCAGTAATATGATAGAATCATGGGA
TGAGAGAACAAGAAATTCAGTAGGAAAATCGGAGGTTAAGGTGGACGATGATCTCAAGAG
TTTGTCAGCAGATATAATCTCAAGAGCTTGTTTCGGAAGCAGCTATGCTGAGGGGGAACA
GATGTTCCTAAAACTTCAAACACTTCAAATGGTTATGTCCAAAGTTCCCATTGGAGTTCC
TGGATTGAGGCATATTCCAAGTAAACATAATAGGGAGATATGGAGATTGGACAAAGAGAT
TAAAGCAATGATATTGAAGATAGTACGAGCACGGAGAAGCCCTACTCATGAGAAAAACCT
TCTGAAACTGATACTTGATGCTGCTAAGAGTTATGAAGAGAGTGGTGGTGATCAGCTACC
AGCTGACGTTTCTGCTGAAATGTTCATTGTTGATAATTGCAAGAGCATATACTTTGCTGG
CCATGAGAACACTGGTCTCACAGCATCATGGTGTTTGATGCTACTAGCTGCATATCCAGA
ATGGCAAGCTCGTGCCCGTGCTGAGGTGCTTGATGTGTGTGGTAGTGAGTTGCCAAATGA
TTCTATGCTTAGACAAATGAAAGTGCTGACAATGATCATCCATGAAACGTTACGTTTGTA
CCCACCAGTAGCATTCGTGGTGAGAGAAGCATTGCAGGATATAAGTATCGAGAGAATTGA
GATTCCAAAAGGGACTAATATTGAGATTCCAATCCCAATCCTGCATCGGCAGCCTGAACT
CTGGGGACAAGATACCTATCAGTTCAATCCAGAAAGATTTGCCAAGGGCATTGCAAAGGC
TTGCAAAGTCCCAAGTGCTTATATACCATTTGGCATAGGGAGTAGAACCTGTGTGGGGCA
AAATTTTGCAATGATTGAACTGAAGGTGATTGTATCGATGATTTTGTCTAGGTTTACATT
TTCGTTGTCACCAGGATATCAACACAGCCCTGTTTTTAGATTAGTATTAGAACCTGAGCA
TGGCATCTATTTGTATCTCCAAAGAATTTGACATATTTCTCTTCTTGGATATTTGTCGAT
GCCTGTAAATTGTAATCTATTAAGTTCAAATGACCTAAGAAAGGTTTAATGAGTAGTTCT
TCAGTCATGTTACTTTTTACAAACCATCTCCTAGAGCAACACAACAGAGGAGCAAGAGAA
ACTACTGTTGTTACTTGTGCTGTCAATAAATATTGCAATCATGCTATTCTTCCATTAGAA
AACTCAATGATACATGTTCC