Microarray Probes on PGSC0003DMT400004090

Probe IDChipProbe Sequence
CUST_36787_PI426222305 JHI_St_60k_v1 AGATTTATGTTTTTCCTTGTAGTGGTGTTTTTAAGCACCCTGTGAGAGAAGTCATGTTAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400004090

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400004090 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G34760.1 +2 2e-48 157 76/105 (72%) SAUR-like auxin-responsive protein family | chr4:16582471-16582794 REVERSE LENGTH=107

Transcript Sequence (659 bp)

>PGSC0003DMT400004090 659 pgsc_dm_v3.4
TCACAAGTCTACATTAGTCTTTCTTCATATATACACCAAAAACTCTCAACTTTCTTTATA
TTTAAAATTTCTACATACCAAAATGGCCATTAGAAAATCAAACAAACTTCCACAAGTTGT
ACTTTTAAAGCAAATAATGAAAAAATGTTCCAGTTTGGTTAAGAAGAACGACTATGATGG
TGAAGACCGCCTTCCGATTGACGTACCAAAAGGACATTTTGCAGTTTACGTTGGAGAAAA
TAGAACTCGATACATCGTACCTATTTCTTTTTTGACTCATCCCGAGTTTCAATGCCTCCT
TCGTTGTGCTGAGGAAGAATTTGGGTTCGATCATGACATGGGCATCACAATTCCTTGCGA
AGAATTCATTTTCCAATCACTCACTTCCGTCCTGAGATAATAAATTATTTAAAAAGAGAA
AAAAAATGTGAATATTAGGTGTAAGGGTTAATTTTTGAGTGAAGAAAGATGGGTTCAAGA
TGAAGCAATTTGCTTCTCTTTTTTCAATCATTTTTCTTCACTCTGTTTTTTAAAATATTT
TTTGTGAGTTTTGAGTAACCCTGACCTAGGAATCACATGGATATTAGTAATGTTTCAGAT
TTATGTTTTTCCTTGTAGTGGTGTTTTTAAGCACCCTGTGAGAGAAGTCATGTTAATCT