Microarray Probes on PGSC0003DMT400003839

Probe IDChipProbe Sequence
CUST_5291_PI426222305 JHI_St_60k_v1 TAAGCCCTTCCAGTGTTCATCCAAAGAAACCTTCCAGAGCTTTATTTATGCAGATTTTGG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400003839

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400003839 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G35560.2 +3 2e-80 270 149/337 (44%) Transducin/WD40 repeat-like superfamily protein | chr4:16881562-16886878 FORWARD LENGTH=1050

Transcript Sequence (1266 bp)

>PGSC0003DMT400003839 1266 pgsc_dm_v3.4
TTTATTCGGACCCTTGAGATACAAAGTTCCCAGTGACCTGTTTTCCTGTGATTGTATAAG
GGGGAGTATGTGACATAGTGAAGATGCTTTTCAAGTCGACTGTTTATATTAAAAGATTGA
GTATTTGAAATCCCATAATTTGTGGTATGCAGGTGGTATTAATTGATTCTGACAGCAAGA
CCATACTGTATCAAACACATATTGCCAGTGAACTCTGTGCAGGTGTCATCTCTATGCAGT
TCAACACGTGTAGCTTGCATGGATTCGACAAGAATATCTTAGTGGTAGCGACTAAGGATT
CATCAATCTTGGCCCTTGAGACAGAAACAGGAAATATACTAAGCCCTTCCAGTGTTCATC
CAAAGAAACCTTCCAGAGCTTTATTTATGCAGATTTTGGATGGACAAGAAATGTCTGGTC
GAGGATTAAGCATTTTAGATGGTATAGACATGATTAAGGGGAATTCGGATAATATTGCAT
CAAAGCAACCATTAGGATTGATTTGTTCTGAAAAAGCTGTGTATGTCTATTCCTTATTGC
ATATTATTCAGGGTATTAAGAAAGTATACTACAAAAAGAAGTTTCATTCCTCTCTGTGTT
GCTGGGCATCAACATTTGACACACCTGAGGCCGGCCTTATGCTTCTCTTCTCGAATGGAA
AGATTGAGATTAGGTCTCTTCCAGAGTTGTCCCTTCTAAAGGAAACTTCAGTTAGAGGCC
TCGTACTTTCGCCGCCGAAGGTAAACGCCATAGCTGACCATTCAGTATGCGCGTCAAAAA
CTGGTGAACTCATAGTGGTTGACAGGGATCAAGAAATGTTCTTCGTCTCAGTTTCCTTGC
AAAATGACTCCTTCAGGTTCCTGGACTTTGCTTCCCATGTTTACGATAGAGATCTAGTGG
TTGAACCAGGGAAGATCTCTGCACCCATCATCCAAAAAGAAAAAAAAAAGGGAATTTTTG
GATCTGTTTTCAAAGATGCCAAGGGAAATAAAGCAAACAATGTGCCTGACGCCGAAGTTG
AAAATGCAAGAGTAAGTATTGAAGAGATGTCTGCAATATTTTCAGCTGACAACTTTCCAT
CACTCACACACAGTGAAGAGAAGTTAAGCAGGAACGAAAAGGATGCTGACTTGGATATAG
GTATTGTTTATCGCTTGTAATGGTTGTCCGCTACTTCATCATTCACTTCTTCCATTGAAC
TGAATACCTGGCAACGACATGATAAGGGCCTGCATAATGCTCTTCTCAGACTAAACTGAA
AATCAG