Microarray Probes on PGSC0003DMT400003777

Probe IDChipProbe Sequence
CUST_5193_PI426222305 JHI_St_60k_v1 ATCCTTCTGTCTACGCTAAATGGGTGTCACTACCTATACACATGAAGCCACAAGCACAGT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400003777

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400003777 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G60000.1 +1 2e-86 266 128/175 (73%) RNA-binding (RRM/RBD/RNP motifs) family protein | chr1:22093678-22094540 REVERSE LENGTH=258

Transcript Sequence (1173 bp)

>PGSC0003DMT400003777 1173 pgsc_dm_v3.4
ATGGGTGTCACTACCTATACACATGAAGCCACAAGCACAGTGTCCCCTACTAGGTTGTTC
AAAGCTTTGGTTGTTGATGCTGACAATCTTATCCCTAAATTGATGCCAAATGTTAAGAAT
GTTGAGACTGAGGGAGATGGAAGTATCAAGAAGATGAACTTTGTTGAAGGTGGTCCAATA
AAGTACTTGAAGCACAAGATTCATGCAATTGATGACAAGAATTTGGTAACAAAATATTCA
CTTATAGAAGGTGATGTTCTTGGAGACAAATTGGAATCAATTACCTATGATATCAAATTT
GAAGCTGCTGGAAATGGAGGTTGTGTTTGCAAGACAAAAACTGAGTACCACACAAAAGGT
GACTATGTTTTAAAGGAAGAAGAACACAATGAAGGCAAGAAACAAGCCATGGAACTTTTC
AAGGCTGTCGAAGATTACCTCCTCACTAATCCTTCTGTCTACGCTAATGAAGTGACGTCG
ATTTACAAGAAGTGGAGGGTATTGCCGAGGCTGGCAGCTGCGGTGGTGCAAGAGGAGGTG
GAAGCGGCGGTGACGGAGGAGGAGGAAGAGGTGCCGGTGCCGGCGGTGGATGAGGAGGAG
GAGAAGGTAGGAGAGGGTTTCGATGGGAGTAGTGAAAGTGAAGGTGTTAATACTAAGCTT
TATTTTGGGAATTTGCCGTATCTTTGTGATAGTGCACAACTTGCTGGGATTGTTCAAGAC
TATGCTAGTCCTGAGCTTGTTGAGGTTCTTTATGATAGGGACACAGGTAAAAGCAGAGGA
TTTGCTTTTGTGACAATGAGTTCTCTTGAAGATTGCAAGACAGTCGTCGAAAATCTAGAT
GGAAGAGAGTATGGTGGCAGAACCTTAAGGGTGAATTTCTCGGACAAGCCTAAACCAAAA
GAACCCCTTTACCCTGAAACAGAACACAAGCTCTTCGTTGGTAATTTGGCGTGGTCAGTC
TCATCTGAAAGTTTGGCACAAGCATTTCAAGAATATGGAGCTGTTGTTGGAGCTAGGGTA
CTATATGATGGTGAGACCGGGAGATCACGTGGCTACGGTTTTGTGAGCTTTGAGACTAGA
GAAGAAATGGAGAATGCTCTTAACAATCTCAATGGAGTGGAATTGGATGGAAGGGCATTG
CGAGTTAGCTTAGCAGAAGGGAAGAAACAATAA