Microarray Probes on PGSC0003DMT400003637

Probe IDChipProbe Sequence
CUST_1472_PI426222305 JHI_St_60k_v1 ATTGTTCATGATTCCCTCTGGTTTGAGTCCTTCTGGATTCCTTAATTCTCCTGGCTTTCT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400003637

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400003637 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG) Solyc02g088340.2 +1 0.0 835 427/460 (93%) genomic_reference:SL2.50ch02 gene_region:45045827-45048579 transcript_region:SL2.50ch02:45045827..45048579- go_terms:GO:0005515,GO:0003700 functional_description:WRKY transcription factor-c (AHRD V1 **** Q5DJV3_CAPAN); contains Interpro domain(s) IPR003657 DNA-binding WRKY
TAIR PP10 AT2G03340.1 +1 3e-105 330 211/483 (44%) WRKY DNA-binding protein 3 | chr2:1014724-1016936 REVERSE LENGTH=513

Transcript Sequence (1785 bp)

>PGSC0003DMT400003637 1785 pgsc_dm_v3.4
GAAAAGCAACTCCACTTTCTTCTCTTTTTTTTTCTCTTGAGAAGAAGAAGAAGACTGAAA
ATGGGGGAAACAGGGGAAGCTTCAGCAATATCGTTTCCATCTTTAACAATTCCACCTCGC
CCTTCATTCGAATCCTTTTTTAACATGTCTTCTTTCAGCCCAGGTCCAATGTCTCTTGTT
TCCAGTTTCTTATCTGATCAGAGCCCTGATTCTGCAGATTGTCCTCCTTCTTTCTCCCAG
CTTCTCGCCGGATACGAATATTCTGGAGATCTTGCAGGGTGTCAAAACAACTCTGTGTAT
AACCCTGTGAATCCTCAATTGTTCATGATTCCCTCTGGTTTGAGTCCTTCTGGATTCCTT
AATTCTCCTGGCTTTCTTTCCCCACTTCAGAGTCCCTTTGGAATGTCACATCAGCAGGCT
CTAGCACATGTTACAGCACAGGCTGAATTTTCTAGTTCATATATGCAAGCCGAAGATCAG
TGTTCCTCTCAGGTGGCTTCAGTAGAAGCATTAGGACATGAGTTGTCGATTGATCCAAAT
GAGTTTTCTTTGCAGATAAAGGAATGTCTGCGAACTAGTTTGGATAACAAACCATCAGAC
AATCAGGGTAAGCAATTTGAACAACCGGAGGTTTCTCAATCTGAGAACAAGACCTCCTTT
GGTGCTCTCGATAAGCCAGCTTGTGATGGTTATAACTGGAGAAAATATGGCCAGAAAAAG
GTTAAAGCTAGTGAATGCCCTAGGAGCTACTATAAGTGCACACATCTCAAATGTCTAGTG
AAGAAGAAGGTTGAGCGGTCTGTTGATGGTCACATAACTGAGATAACATATAATGGCCGG
CACAACCATGATCAACCAACCAAACAAAGAAAAAATGGTTCTGCTTTGGATAATACAGAC
TGCTTTGGAGTTCGACCAGATATTAGTACACATGATTGGACAGTAATGAATAGCTCGGAT
GGGTATTCTCCGTCTCGTTCTGACCAGGTTCCAACCCAAATGGCATCTGAACTTCTTGTC
AAAAGAGAATGTGATGAAACCGAAAGCTATTTGATAGACGTAGATGATGAAGGGCATGAT
GAACCAGATGCAAAGAGAATGAAGACGGCAGTTATGCCTGTAGCTTCATCACATGTTACA
GTAGCTGAATCCAAGATTGTTCTGCAGACGAGAAGTGAAGTTGATTTCTTAGATGACGGG
TACAAATGGCGAAAATATGGGCAGAAGGTGGTAAAGGGGACTCAGCATCCAAGGAGTTAC
TATCGGTGCACATATCCTGGATGCAATGTCCGCAAACAAGTCGAGAGGGCTTCAACTGAT
CCAAAAGCTGTCATAACAACATATGACGGCAAGCATAATCATGATATTCCTACTGTTAGG
AATAGAGGAACGAGGAATAAATACAGCCAAAGATAGCATTGAAAACGTAAGAAACTGTGA
CATGAAGGCCTTCAGTTCACAAAAATATCTTGGTTTCCGAAAACAACGAAATTCCCTTGT
GTGAAAAGATTGCAGCATTAGGAAAAGTAGATGTGGTTTGAGCTTCTTACTTCTGTACAA
AAAGCTTATAATTAATAAATCTATCCTTGTTGAAAACCACATGCTTGGTCCCTTGAATTT
GTTGGTTGGTCTCAAGAAATATTTGTAAATTCTATTGCTAGTTTCTAAGATGTCTAATAA
AGCAACGAAAAAAAAGAAAAGGTGTAATAGTTTGTCCTTGTCGTTGAAGCTTCCTGGGCC
AGGCTTCAAACTCTAGTCCAGAAGAATAAAGGAGCTTATTCAAGC