Microarray Probes on PGSC0003DMT400003636

Probe IDChipProbe Sequence
CUST_1373_PI426222305 JHI_St_60k_v1 GATGTGTCCTGTTGTTTTGTTAGATGACATGAATAATCCGCTTATGCATCTAAACTTGAT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400003636

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400003636 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG) Solyc02g088340.2 +2 9e-28 109 51/54 (94%) genomic_reference:SL2.50ch02 gene_region:45045827-45048579 transcript_region:SL2.50ch02:45045827..45048579- go_terms:GO:0005515,GO:0003700 functional_description:WRKY transcription factor-c (AHRD V1 **** Q5DJV3_CAPAN); contains Interpro domain(s) IPR003657 DNA-binding WRKY
TAIR PP10 AT3G01080.1 +2 2e-17 80 34/44 (77%) WRKY DNA-binding protein 58 | chr3:25507-27449 FORWARD LENGTH=423

Transcript Sequence (616 bp)

>PGSC0003DMT400003636 616 pgsc_dm_v3.4
ATATGTTTTCACATGTGTGATGTGTCCTGTTGTTTTGTTAGATGACATGAATAATCCGCT
TATGCATCTAAACTTGATATACAGGAGTTACTATCGGTGCACATATCCTGGATGCAATGT
CCGCAAACAAGTCGAGAGGGCTTCAACTGATCCAAAAGCTGTCATAACAACATATGACGG
CAAGCATAATCATGATATTCCTACTGTTAGGAATAGAGGAACGAGGAATAAATACAGCCA
AAGATAGCATTGAAAACGTAAGAAACTGTGACATGAAGGCCTTCAGTTCACAAAAATATC
TTGGTTTCCGAAAACAACGAAATTCCCTTGTGTGAAAAGATTGCAGCATTAGGAAAAGTA
GATGTGGTTTGAGCTTCTTACTTCTGTACAAAAAGCTTATAATTAATAAATCTATCCTTG
TTGAAAACCACATGCTTGGTCCCTTGAATTTGTTGGTTGGTCTCAAGAAATATTTGTAAA
TTCTATTGCTAGTTTCTAAGATGTCTAATAAAGCAACGAAAAAAAAGAAAAGGTGTAATA
GTTTGTCCTTGTCGTTGAAGCTTCCTGGGCCAGGCTTCAAACTCTAGTCCAGAAGAATAA
AGGAGCTTATTCAAGC