Microarray Probes on PGSC0003DMT400003459

Probe IDChipProbe Sequence
CUST_802_PI426222305 JHI_St_60k_v1 TGTAGATATCGTCGAAAGTGAATGAGTTTAGTTGAATTCAAAGGCGGACCGCGGACCTAC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400003459

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400003459 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG) Solyc02g089080.2 +2 3e-37 135 73/110 (66%) genomic_reference:SL2.50ch02 gene_region:45561116-45563543 transcript_region:SL2.50ch02:45561116..45563543+ functional_description:Rapid alkalinization factor 5 (AHRD V1 *-*- Q6DN46_SOLCH)
TAIR PP10None-----

Transcript Sequence (1085 bp)

>PGSC0003DMT400003459 1085 pgsc_dm_v3.4
TAGGTAGTTGAGGTTGACCATACATAGCTGGTGGATGCTGGGGTTTCCACTAAATGAAGG
TAGGACATAGGACATAGGACAAACAAAGACTATCAAGTCAACTAAGGAAAAAAGGTGTCC
ATTCATCTCTTATCCCATGGTGTGGGCATTAACTGTATCAGCTCACATCTATTAGGAGTC
TATTTAAACAAAACATCAAAGTGAGAAAGGAATAGTAACTCTATCAATTCTTGTAAAAAC
AAATTCCAATATAATATATACCATGGAAAGGAAATGTTACAAGAAGATGACGACGATGCT
CGTTGTGCTACTTGTAACCATAATAAAGGTGCAAGATGTAATTGCGGCATTAGAATGTAA
TGGGACAAGCAGCAACATAGGTGATTGTATTGGAGATGTTGATGAATTCTTGATGGAATC
AGAAACAAGCACTATGATTCTTGCTGGCAAACATCTATCTATAAACGCGCCGGGGGATAC
AGCAAAGATATGTGAGGAATCAATTTACGGTAATTGCATCGATAATCCGAACGTTGTGGC
AACACGCTGCAACTATGGTACCCGCTGCAATCGTGAAATATCCTAGTAAATATTTATGTA
CAAGTCTCCAAGGGCATCGTTTGCTTTACTTGAACCAATAATATCTTCTCTTGTTGAAGA
AACTACTTGTTTTTACATTTTGTATAAATATTGTCTCTTGAGTACTAAATTGATTTTATC
TTAACAGAATGCTTTAGTATGTCTCCAGTTCAATAACTCGATTAGAAACATCAGAAACAA
AGCACTCACCAAAATCATCACTTTCAGACAACATGGTAGAAATGTATAAACATATGTGAT
TCTTATTACATATATATGTAAACGCAATTATAGCCATAAACTGCATAAACAGCACACATA
GACTTTGGTTCTTTGTGGCAGGGTCTATATGTAATTGTAGATATCGTCGAAAGTGAATGA
GTTTAGTTGAATTCAAAGGCGGACCGCGGACCTACCCTCTAGGGTAGGGGTCCATGGATA
ACTTTGTACTATATTTTTTTATAAGCACTCCTAGCGAACAAAGGTAAAGTGGTTTCACTA
GTTGA