Microarray Probes on PGSC0003DMT400003328

Probe IDChipProbe Sequence
CUST_1506_PI426222305 JHI_St_60k_v1 ATCTGTTGTTTGCTGCTAGTGTTAAGATAGGAATCTATGAGTTGAAGAAAGGAGATTTCT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400003328

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400003328 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG) Solyc02g087800.2 +3 0.0 659 338/356 (95%) genomic_reference:SL2.50ch02 gene_region:44662024-44664509 transcript_region:SL2.50ch02:44662024..44664509+ go_terms:GO:0005515,GO:0004034 functional_description:Aldose-1-epimerase-like protein (AHRD V1 **** O48971_TOBAC); contains Interpro domain(s) IPR015443 Aldose-1-epimerase
TAIR PP10 AT5G15140.1 +3 2e-125 377 183/330 (55%) Galactose mutarotase-like superfamily protein | chr5:4908686-4910670 FORWARD LENGTH=490

Transcript Sequence (1333 bp)

>PGSC0003DMT400003328 1333 pgsc_dm_v3.4
CAGAACAGCTCTTTGTTCACATGCTTGCTAATATTCTAATACCACAAAAACAACAATACC
AGATGAATGAACAAGTATATAAATTGAAGGGCTGAAAAAAGCAGTCATTCAAACACTCTA
AAAAACAGAGATCCAAGATGAGTTTGTCTTCAAAGATTAATTTGTTCATCTGTTTGTTCA
TTTTTCATCTGTTGTTTGCTGCTAGTGTTAAGATAGGAATCTATGAGTTGAAGAAAGGAG
ATTTCTCAATTAAGATCACTGATTATGGTGCCACAATCATCTCTGTTCTTCTTCCTGATA
AGAATGGTAAAATAGACGATGTTGTTCTTGGATATGACACCATCAAAGAATATCTGAATG
ATACAAGTTATTTTGGAGCCACCCTTGGAAGAGTAGCTAACCGGATTGGTGGTGCTCAAT
TTACTTTGAATGGAACCCATTATAAGCTTGTTCCCAATGAAGGCAAAAACATGATACATG
GTGGCCCTAAAGGATTTAGCAAAGTTGTCTGGAAGGTGAGCAAGTACGTGCAAGATGGTC
CCAGTCCTTACATAACTCTAACCTACTTCAGTGCTGATGGCGAAGAAGGATTTCCTGGTG
CTGTTCTTGCCTCTGTTACCTTTGCATTGAAAGATCCTTACAAACTTAGTGTTGTATTTA
AGGCGAAAGCTCTGAACAAGGCTACTCCAATTAACCTGTCTCACCACCCTTACTGGAACA
TTGGTGGACACACCAGTGGCGATATCTTGTCCAACGTTATTCAAATCTTTGGATCACACA
TCACACTAGTTGATAAAGAACTCATTCCGACAGGGGAAATTGCCCCCGTCAAGAACACAC
CCTATGATTTCCTGAAACCGCATACAGTAGGGAGCAGGATCAACAAACTCCAAAATGGAT
ATGACATCAACTATGCACTCGACAGCACTGCAAAAATGAAACCCGTGGGGGTAGTTTATG
ATAAGAAGTCCGGAAGAATGATGAATGTAAAAGCATCTGCACCTGGTGTTCAATTCTACA
CTTCAAATTGGGATAAAAGTAAAAAAGGGAAAGGTGGATTTATGTATCCGCCTCATGCAG
CATTGGCTTTGGAAACTCTAGTATTTCCAGACGCTGTGAATCACCCTAATTTTCCATCGT
CAATTGTGAATCCGGGAGATAGATACGTCCATTCAGTGTTGTATACGTTCTCCATCAAAA
AATAATGAGAATGCTTTCATTTTTATTTGTTTCATCATCCTGCATTAATTGACATTTTTG
TCAAGGTTGTAGTGTTCTGTATGACTAATTAAACACCCGGCATTTGACTCAATAAAGGAT
AGTTTTGTTTTGC