Microarray Probes on PGSC0003DMT400003037

Probe IDChipProbe Sequence
CUST_49721_PI426222305 JHI_St_60k_v1 GTAATTTTCAATTTTCGTCAAGTTCAAAGCAGCGTGGTGCTTCCCATGTTATTTGAGAAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400003037

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400003037 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G49480.1 +2 4e-36 129 78/162 (48%) Ca2+-binding protein 1 | chr5:20070812-20071294 FORWARD LENGTH=160

Transcript Sequence (849 bp)

>PGSC0003DMT400003037 849 pgsc_dm_v3.4
CTTGTCAACCAAGCTTAGGAGTATCCCTTGGAATTCTCCTATAAAGTCGCCATCCTTTTT
TATTTTACTCATATATTCTCTACAACCTTTTCAATTTCTTCAATTTACAAAATATTTTAG
TTCTTCAATTACCTGCAAAACACACCGGAAAATGTGTCCCACCGGAAGTGTTTTGCATTC
TGCCGCCGGCGCCGGAAAACCAAATCTCCGGTCAGCTTTCGACGTTTTAGACGTTGACCG
CGATGGAAAGATTAGCAGAGAAGATCTCCGGACATCGTACGGTGGATTCGTCGGCGACGA
TATGATTGGTACGATGATGACGGTGGCCGATTCGAACGAAGACGGATACGTTGAATTTGA
GGATTTCGAGAAGGTTTTGGATAGTTCTATTAACAGAAACGGCGAGGAGAAGAGGAAAAA
TGAAACAGGGATGAATGTAATGGAGGATGTTTTCAAGGTGATTGACAAAGATGGAGATGG
TAAAGTTGGGGTTGAGGATTTGAAGAGTTATTTGAGTTGGGCTGGGCTTCAAGTTGATGA
TGATGATATTAAGGCCATGATTAAATTGGGCCATGGTGAAGAAAATGGTGGTGTTACCTA
TGAAGGTTTTCTCCAAATTTTGTCTCTTTAATTTGTTCCATTGATGAAGATGATAAATGT
TAGATTAGGTGAACAAGGATTTTTTGTAATTTTCAATTTTCGTCAAGTTCAAAGCAGCGT
GGTGCTTCCCATGTTATTTGAGAAAAAAAGGCGCACCATCATTTTGTATGCTACTTTTTC
TGATTTTATTTGATATTATATTGTTTGTTTTGTTTGAAAATCAAGTTTTTATATCTCAAA
TAAAAATAT