Microarray Probes on PGSC0003DMT400002201

Probe IDChipProbe Sequence
CUST_47084_PI426222305 JHI_St_60k_v1 GCTGAATTAACCATAGTACAAGCATAATAACACCTACACTCAATGTGCATCAAGACTTTA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400002201

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400002201 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G62040.1 +1 3e-110 325 176/242 (73%) Haloacid dehalogenase-like hydrolase (HAD) superfamily protein | chr3:22975328-22976518 REVERSE LENGTH=249

Transcript Sequence (1036 bp)

>PGSC0003DMT400002201 1036 pgsc_dm_v3.4
AATCAAGGCAATTATATATATCATATACGTAATTTGTAACTTGTAGGTGCAGGAAGCTGC
TGTCGAGCTAGCTTCATTTCTTCAAGATTTTCATCAACCAGCAAGGTGAAGCTACTCTTG
AGAATGGAAAGCGTTGCAAGGTCCAACACTCTTAAGTATGAGTGTATGTTGTTTGATATG
GATGACACTTTGTATCCTCTTAGCTCAGGTGTCAACCTAGCTTGTCGCAAAAATATAGAA
GAATATATGTTGCATCACCTGAATATTGAAGAAAGTGAAGTGCCAAAAATGTGCTTGGAT
TTATACAGAGAATACGGCACAACAATGGCAGGCTTGAAGGAGCTGGGGTACGAATTTGAC
AACGACAAGTTTCATGAATATGTGCATGGAAGATTGCCATATGAGGTGCTAAAACCTGAT
CCACTACTAAGGAACCTCCTACTTTCCATGCCACAACGCAAAATTATATTTACAAATGGT
GATAAAGCACATGCAATTAGAGTTCTGAGCAAGTTGGGACTGGGAGATTGTTTTGAAGGT
ATTATATGCTTTGAAACTCTGAATCCTTCCTTAGAGGATAATGCTACTATTTTATGCAAG
CCTTCTCTCAAAGCAATGGAGGCTGCTATTCAGATTGCAAACCTTGATCCAAACAAAACT
ATTTTTTTCGACGATAGCGCTCGGAACATAGCAAGTGGTAAACAAGCTGGACTCCACACG
GTGGTTGTGGGTAGCTCAACTTTGGTAGCAGGGGCAGATCACGCCTTGAGGAGCATACAC
AACATAAGAGAAGCCCTTCCTCATATATGGGAAGAAGAAGGAGATTTACCGCAAAAAATT
ATCCAATCCAATGCTGCTGAATTAACCATAGTACAAGCATAATAACACCTACACTCAATG
TGCATCAAGACTTTAATTTGATGAATTTCAATAAAAAAAATCTACGTGAAATGAAATAAT
AAGTCATTATATATGTATCCAATAATAGTGTACGAGTTACATTTATAGCACTATATAATA
TAAGTCATTATATTTG