Microarray Probes on PGSC0003DMT400002060

Probe IDChipProbe Sequence
CUST_43228_PI426222305 JHI_St_60k_v1 GGGGTGGGGGTCTAAACTTATTCTTACTTGAAAAATGACAGTTAACTGTCACATTGTTGT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400002060

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400002060 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G52440.1 +2 8e-37 135 70/122 (57%) Dof-type zinc finger DNA-binding family protein | chr3:19435447-19436190 FORWARD LENGTH=247

Transcript Sequence (1036 bp)

>PGSC0003DMT400002060 1036 pgsc_dm_v3.4
TCCAAATCTAACTTCTTTCTAGTCTTCAAAGAGTATTACATATATATTTATTCACAAAAA
CATGTTACCGTACCATCCAAGGCCAATGATCATGATGGAAAGGACAAGAAAGTCCAATAT
TGAACAAGCACCAAATTGTCCTAGATGTGCATCTACCAACACAAAATTTTGTTACTACAA
CAACTATAGCTTGTCACAACCTAGGTATTTTTGCAAAGCTTGTCGTAGATATTGGACTAA
AGGTGGTTCTCTTCGAAATGTCCCCGTTGGTGGCGGTTGTCGGAAAAGTCGGCGTTCAAG
ATCTACACAAAAAGACGATAATACCCTTCAAACATCGAGTCCCGCCCTCGAAGGCGCTCC
CGGAGCTCATGACATTGATCTAGCCGATGTTTTCGCTAAGTATTTGAACCAAGGTACAAA
TAATGATCATGATGATAATATTATTATTCAAGAATCTCAAGATTATTCTTCTATTGGAGC
AAGCTTATCTAATTCTCCTTCATCAGATAGCTTGGTTAATAATCCAACTTCTTTTGAGAA
TGAAAGTTTGTTGGATAATTTCCAAGATTACCCTTGTGGTAATTTTCTTCAAGAGGAGCA
AGGGGGTCAAAATAATCAAGATTTTCTTGATTTTAACACTAGCTTTCTTGAAATGCAAGC
TATACTTGGACAAGAGGAGGATCAATTTGATCATTATAACACAAGTAATTTTGAGTGGCA
ACCAATGATGCAATTTCAAGATTTTGGATCAATTTTAGAACTAGATGATCATCAACTCAT
AAAGAATTCAACAACAAACTTAGCAAGTCATGACAATAACAACAACAACTATAGTTCATT
TGATCTATCCAACTATATATGAAATTTACTTAAGGTGCAAAGGGTATCTTCTTTATTTTT
TTTTATTTTTTTTTTGGTTTGGTGGGGGTGGGGGTCTAAACTTATTCTTACTTGAAAAAT
GACAGTTAACTGTCACATTGTTGTTTGAAAGAGACTTGTGAGAAATACAGGATGAATATA
ATAAAAAAAATACACA