Microarray Probes on PGSC0003DMT400001938

Probe IDChipProbe Sequence
CUST_46799_PI426222305 JHI_St_60k_v1 ACTATTCACCTCATGATGTTTGCTCTACTTCTCTTTACAGGTCTAGTTCCTGGTGATTTC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400001938

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400001938 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G34570.1 +1 2e-33 129 61/95 (64%) thymidylate synthase 2 | chr4:16511129-16514110 REVERSE LENGTH=565

Transcript Sequence (901 bp)

>PGSC0003DMT400001938 901 pgsc_dm_v3.4
CATTTACTTGGTGAGGCATTTGAAAATGGAACTTTACCCTTCTCATGAGACTCAATCCTT
GTCCTTTATGAGACAATCCTATGCCTTAATACTTCTAGCTAAGTTTCTAAGTAGTACTGC
TTGGTGAGATGGCCAATTACTTTGTATGTGTATTGTTAAAAACAGATCCAACTTGTAAAA
GGATATGGAACTTTTGAACATTTGATTTGTAAATTTTCATGTATATTGATAATGGAGACG
TATCTTTTGATGGTCATTCACTGGTCATTCTACATCCAGGTTCCAGCCCACTTCAGTTCC
TTCTGTTTTACTATTCACCTCATGATGTTTGCTCTACTTCTCTTTACAGGTCTAGTTCCT
GGTGATTTCATACATGTCGTAGGAGATGCTCATGTTTATCGCAATCATGTCAGACCTCTG
CAAGACCAGCTTCAGAAGCTGCCTAGACCTTTCCCAGTGCTGAAGATCAATCCGCAGAAG
AAGGACATAGAATCCTTTGTTGCTGCTGACTTTGAGCTTACCGGCTATGATCCTCACCAA
AGAATTGAAATGAAAATGGCAATATGAAGTTCCATGCAGTTAGTCCTGAATTCCTCTGCT
CTTAGGATATGTGGCTCATATTTTGAGATTGGAGAACCGAGGATGTCTTGAGGAGTTATT
TTATAATTTGAATCTTCATTAGTAGTATATTTGAGGAAAAAACATCTAAGTATTAGGATC
TGCGAATCCTTTAGCTCCAAAACAATGGATGTGTGGTTGCTAAGGTGATTTAGAATGCTA
TGGCTTTCCTTTTGTGTTGAGACTTACCTTTTTGGCTTTCTATGACAATACCCTTTCTCT
TATAAGATGTATTATTTATGTTTTCGCTCATTTATTTGCGTATTGTTTCATGGCTTTTGT
T