Microarray Probes on PGSC0003DMT400001924

Probe IDChipProbe Sequence
CUST_46785_PI426222305 JHI_St_60k_v1 GGATATCACTACCTAGCAAGTCAAGTATATGACAAATGAAAAAAGGAAAAAAGATGCCCT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400001924

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400001924 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G75250.1 +3 3e-27 101 47/64 (73%) RAD-like 6 | chr1:28245073-28245453 REVERSE LENGTH=126

Transcript Sequence (528 bp)

>PGSC0003DMT400001924 528 pgsc_dm_v3.4
ATTAAGTACTTTTCCTCTTTGGACAAAATATATCGCTTTTTTTTGTAGTAATGGCATCAA
GCTCACTTCAATCTTCATCATGGACACCGCAGCAAAACAAGTTATTTGAAAGGGCACTAG
CTCAATTCGATAAGGACACACCTGACCGGTGGCAGAATGTGGCGCGGGCGGTTGGAGGTG
GAAAATCGGCCGATGAAGTAAAGAGACACTATGAAATACTTATTGAGGATCTCAGCCGCA
TTGAATCTGGACGTGTTCCTCTTCCTACTTACACCCATGAACAACAAAGGCTTTTGAGGT
ATATGAACCTGCACTAGGGAAGATGTTGACAAGAAGATATTATACTGGATATCACTACCT
AGCAAGTCAAGTATATGACAAATGAAAAAAGGAAAAAAGATGCCCTTAAAAATATTCTAT
GAATATTGCATTGTACCTTCTCTTAATTATGAAAAATAATTTTTTTTTCTACCACTTCCA
ACATGTTTTTATTGTATTGTACTAGTACCACAATATCTTATCAAATCG