Microarray Probes on PGSC0003DMT400001872

Probe IDChipProbe Sequence
CUST_46796_PI426222305 JHI_St_60k_v1 CATGCAGTTAGGTTGCAGAAATTCTGCGGATTTCAAAAGGTTATGTTAGCTGGTAGGTTA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400001872

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400001872 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G05675.2 +1 2e-25 109 123/460 (27%) BTB/POZ domain-containing protein | chr3:1658425-1659859 REVERSE LENGTH=441

Transcript Sequence (2171 bp)

>PGSC0003DMT400001872 2171 pgsc_dm_v3.4
CTTTATTACATTAATTAATTTACTACACTGTTCTGAACACTTCGATCAGAAATCCCAATC
GTCCTTATCTGAAACTTGATCTTCATCGCGAAGGACCTCTAGCAGAATCATATGACGGCA
GGCGGCGGTGGTGGTGGCGGTGCCGGCGGAGTCACCTCCGGCAAAAAACGACAACGTTCT
GGTAGTTATAGTCGACTTTCCTCTACTATAGGAATCATCGACTCTTCTCGTCCTGATAAT
ACCCTAACGGAACGCACACAGAAGACATCAGGTATTCGCCGCACAGCTTCTCACACCTTT
ATTGCACCGTCGTCCTCCGCTGCTGTTAGCCGCGGATTCAACGATTCAGCCACGGCTGAC
GTCGTGCTTCGTCTCTTTGTCGATCAATTGCCGCTGTTCGATACCGATGATTCCGAATCC
ATTTCAGCCGTCGATTCTGATCAATCCGATGTCCAGATCTATCTCCACTCCGATGTTCTC
TGCCGTTCTAAGTATTTCGCTACTCTCTTATCCGACCGCTGGCAAAAGGAATCAAACGAC
GTCGATTCCGGGAATTCTTCAAGGATATTCCGACTTAATCTCGGCGTTCCCGCTACTCCT
GGATCAATCGATCATCATTTGGCTGTTCTTCAGCTTCTATATACCAATGACTTCTCGACA
ACTATCCACAATGTTTCGGTAGCGTTGTGTTTACTTCCGGTGGCTTTGGAACTAATATTC
GAAGATTGCATTAAGGCTTGTGTTCGGTTCCTTGAGGCCGTACCATGGGCTGAAGATGAA
GAAAGGAAAATACTCAGTATAGTTCCCTTGCTAAGCAAGGAGGAATCTCAAGAGCTTCTC
GCTAGGGTTTCGATTGACAAAATTGATTCGTCCGAACAAATGCTTCATGGATTGATATTA
TCAGCACTTCATAACCATCCTAACATGGCATTCGCTAAGGCATTTGTAGCTAAGCTGTTG
AGGGACTTTTCGTCCAAAGAGGCGGCGAAGAGAGTGTTGGACGGTGCTTTTCAGAGTAGC
TTGAAGATTGTGAAGGAGTCGTTGGAGGAGTACTCAAGTCCTGACTTTAGAGGTGATCAC
AATGAGATTGAGGCAATTCAGAGGCTGAATTTGCATACTGCAATGACAAATGGGAGGCAT
TTGGTGTGGTTGGTGGAGAGGATGATTGAACTGAGAGTGGCCGATACAGCTGTACAAGAG
TGGAGCAATCAGGCCGCATTTACTGCTGATTTGCTGAGGGCTCTCCGTGATGATGCATGG
AGGAACATCGTTCCAGGGCTTCCTGCAGTTGTGCTTCGATGCACTTGCAAGCTTTCTAAT
GCAGTCGCCACGGGGACTATCTTGGCCACCAGACAGGTTAGAATGAAGATCGTGAAAGAT
TGGCTTCCAGTGTTGATTTTGTGCAAAGACTATGTAACACCGATGACGCCAAGTCACAAA
ACAATATATGTGGAGCTGGAAGACACGTTTTTGAGGATTATATCCACGCTTCCCTTGTCT
GATGCCCAGGAGTTATTGCAACAGTGTCTCAGCTTTTCAACTAGAAATGTTGAAGACTGT
CCTCACTTAATCAGCGCGTTTACCACCTGGTTCCGACGAGCAAATAGATTCCCCCTACCA
GATATGTGATGGTTCGGTGGATGAGGATGGGGACAGTTTGGTGTCTAATGTCCATACTAG
TATCTCCATTGCAAGAGACACTGTTATTTGTACATAAAACGTGTTGTCTCACCTTTGTAC
TAGAAGTTATGTGGATTGTGCGACTCTTAGGTTGGTTACTTGGTGTTGCGCAGTATCCTT
GACTGTAAGCATTGGTTATTAAGAGAATGACCAGCATGTACATAAGACATTGTGGCGTAT
GAAATCTGCCCATTTTATGTCTTTTAATTGCATTTCTTCTCTCTTTCACTCAGGGAGGTA
GAAATTGGCTTCTATTATGTGTGTTCTAACAAAATTTGGCAGGTAAGCATGGCATTCGAT
GGCTTGTTACAGTGTCGAAGGGGGGCTTTTTCCGAAACTATTCACAGGAAATTTCGTAAT
GCACTGGGATAGTAATGTATAGCCATGTATCTAATATTCTAGGAATTACTTAGGAGCTTT
TGAAAATATTTCATGCAGTTAGGTTGCAGAAATTCTGCGGATTTCAAAAGGTTATGTTAG
CTGGTAGGTTA