Microarray Probes on PGSC0003DMT400001661

Probe IDChipProbe Sequence
CUST_45328_PI426222305 JHI_St_60k_v1 CCTGATCTTTCTGTGATCTGTACTTTGTGATATATTGTGGTCTTCTAGTATCTTACTAAC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400001661

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400001661 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G15790.1 +2 4e-31 121 67/105 (64%) methyl-CPG-binding domain 11 | chr3:5343209-5344386 FORWARD LENGTH=254

Transcript Sequence (1430 bp)

>PGSC0003DMT400001661 1430 pgsc_dm_v3.4
CACTTGTGCGACGTGTGATAAATCTGTTGCGTGTTTGAGGCGGTTTCCTATGAGTTGCGG
CGTCTTTTAAGTATATGTCAAGCAAGCTTCATAAATGGTTGTACTGATGCAAAAACAGAG
CTAAGTTGTAGTTTTTGAGTTTTGATATTTGGAGAAGACAATAATGGCAAGTAACAATAT
GGATCTTTCGCCTGTGGAGCTTCCTGCGGCGCCTCTGTCTTGGAAGAAACTGCTCATGCT
GAAAAAGGGTGTTAGAGCAAAGAAGAATGAGGTTGTATTTGTTGCTCCAACAGGAGAGGA
GATAAGGAATAAGAGGCAGTTGGAGAAGTACCTGAAAACACACGATGGAAATCCTGGTAT
GTCAGAATTTGATTGGACTACTGGTGAGGCTCCAAGGAGATCAGCACGGATCAGTCAGAA
GGTTAAGGCAATGCCACTTCCAGCAGTGCTTGAGCCGGCAAAGAAGCGACAACGTACGTC
TTATGCTACAAAAAAAGAAGAGGAAATGGATATCGCAGATATAGAGAAGGAAAACATGGA
ATCTGCCATAGAAGAAAAGGAAGGCTTGGAGAAGGAGGAGAATATAGTAGAAGTTGAAAT
GGAGGACAAGGGGGGTGAGATGGGCGCTAATAAGGAAAATACAGAGCATAAAAAAGAAGA
GGAAATGGCTGGTACAGAGGTTTCAGATAGGAAAACTGAGGCCAGCAATGACATTCAGTT
TGAGGATGGAGGAGATAAAATGGCTGAAAATGTTACAGAGGAGACTATAGCAATTGATGC
CGACTTCTGGAATGATTCCATGGACAAGGACTATTTCAAGGGAGTGTTTGCAAATGCTGT
AATTGGAGAAACAAATGGTGCTGAAGCAGGAATAGAAGTCGGGGAGAAACCAGGATACGG
GGAAAATCTAGAGTCCCAGATTGATATAGACATTAGTGGAGCAGATAACATGAATCACGA
CATTCCAGATAAGGGTACACCAGAAAGAAAAGTCGCAGGAGGAGAGACGTACAACATTCA
GGACCCTGCATTTGTTGGAGAAGCTAGTGGTTTCCGTGAAGAGCCTAATTCGGTGGAGGA
GGAGAAAAATAAGAACAGGGCTGGCCTGGTTATGGATAATTGCCAGATTAATCAGCCAGA
GCGAGCACATACCCCACAACATCAATCTGTTGCCACCATTAGTTGTTGAGTGTAGCATCT
AAAATAAATTAGGCCTTCGCCCAGTGCATGTTTAATCCGTACTAGGACGATTATAATAGT
TTGCTTAGTAGTTTAGGAATTAGCGTTTTAGAGATCAACTTTCCTGATCTTTCTGTGATC
TGTACTTTGTGATATATTGTGGTCTTCTAGTATCTTACTAACATAAATAAATGTCAACTT
GTTCATTGTGATCTTTCTTGTTTATTGGTACTGCTGAAATTCAATATATA