Microarray Probes on PGSC0003DMT400001613

Probe IDChipProbe Sequence
CUST_45376_PI426222305 JHI_St_60k_v1 GGCCACAGTTTTAACAGAAGAAGGAGTATTTGATGAGTGATTTTGTCAAAATTTCTCTGA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400001613

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400001613 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G47620.1 +2 3e-45 168 155/312 (50%) TEOSINTE BRANCHED, cycloidea and PCF (TCP) 14 | chr3:17559004-17560473 FORWARD LENGTH=489

Transcript Sequence (1782 bp)

>PGSC0003DMT400001613 1782 pgsc_dm_v3.4
ATTCATTCAAAGAGAGAGAAAGAAACATACACAGACCCACAAAGAATTAAATATAGTGTC
TGTCACTATTTTCTCATAAAAAGAACTTGGCCTGCCTAGTGAGAAAAAAAAAGAGAAAGA
AGGGGCTCATTTTAATTTTTTTTAAGAGCGAGTTTTTAGTCATTACTACTTTGTGAACAT
GGATGGAGGAGGTGATGATCATCTCCACCAACACCACCAACACCATCACCAACACAATCA
CCGCCCTATCGCGACTTTTCCGTTCCAATTACTTGAGAAAAAAGAAGACGAAGCTTGTTC
CAGTTCATCCAACGCTGCAGCTGCTTATACTACTTCTCTTGCCATTTCAAACACAGATAA
TACTCATACAAATCCTAATAATACACCTCGATCAACAACTTCAACTCTTCAAATCTCAGC
TTCTGGTGCCGATACATCTAAAAAGCCGCCCCCAAAGCGAACCTCCACCAAAGACCGCCA
TACTAAGGTTGATGGTCGTGGCAGACGTATCCGCATGCCTGCGCTTTGTGCAGCTAGGGT
TTTTCAGCTCACACGGGAACTCGGTCATAAATCCGATGGTGAAACCATAGAGTGGCTACT
TCAACAAGCGGAACCATCAGTAATCGCCGCTACAGGAACCGGTACAATTCCAGCAAACTT
CACGTCGCTTAATATTTCACTACGTAGCTCAGGCTCCAGCATGTCAGTACCTTCACAGCT
ACGATCTTCATATTTCAATCCGAATTTTTCGCTCTCACAACGACGAGGGCTATTTCCTCC
GGGAATTGGATTGTCGACTGATACTTCAGCTACTACGTTGTTGAATTTTCAGTCGGCGAA
TTTAAGCCCTAATATGCAGTTACAAACAAAGCCTGAATTGCGTGACAATTCAATCGATTT
AACGGAGTCGAGTCCGGCGGAGGATAATTTAAGTAGGAAACGAAGGTCAGATTTAGATTT
GGAGCAGCAGCAGCATCAACAACAACAGCAAATGGGAAGCTATTTGCTACAGTCGAGTAC
TGGTCCGATGCCAACAGGCCATTCTTCAATTCCGGCTAATTTTTGGATGGTGACGAATCC
GATTCCTAGTAACCAAGTGATGGGAGGCGATCCGATTTGGCCGTTTCAATCAGTAAGCAA
TTCTGGTGCAGCAGCTGCTTTGTATAGAGGCACAATGCCAAGTGGATTGCAATTTATGAA
TTTTCCCACTCCAGTTGCGCTTTTGCCTAGTCAGCAACTAGGCGGCGGCAGTAGCGGTGG
CGGCGGTAATAATGGATTGGGAGAAGGTCAATTAGGCATGTTTGCCGGACTAAATCCGTA
TAGAGGTGGTGGCGGTGTATCGGAATCTCAGGCGAGTGGGTCCCATTCGCATCACGGCGG
TGGCACGGATGATCGGCACGATACAACGAGCCATCATTCATAGCTATAGACTGCTGATTG
ATTGATCATCAAATTCATCCATTCTTTCCCAACTTGTGTTTTGTAAGTTTGGATGTTTAA
AGTTCCTTATATTTTTCTTTTTTGTTGTTAAATTTGTTCTGAACATTCTTTTTTCTTTCT
TCACCTTTTTTATCGTGTGATTAATTTGCCTTACGAGTTTGAAGAGGCCACAGTTTTAAC
AGAAGAAGGAGTATTTGATGAGTGATTTTGTCAAAATTTCTCTGAATTGTTTTTCCAATT
TTAGAGTCGTTTGCTATTCATCATCATTTGATTGTTCTTTTTTATCTTTCTTCTAAAGTT
ACATGTACAAACATTATTACAGTAAGTTAATTTGTTCTGGAT