Microarray Probes on PGSC0003DMT400001571

Probe IDChipProbe Sequence
CUST_17388_PI426222305 JHI_St_60k_v1 AGTATACATCCGCCAAATTAAACTAATCGCGTTGGGTCTATTGTACACCATATATATTTG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400001571

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400001571 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G53730.1 +3 6e-71 221 124/215 (58%) Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family | chr5:21808072-21808713 REVERSE LENGTH=213

Transcript Sequence (893 bp)

>PGSC0003DMT400001571 893 pgsc_dm_v3.4
TTCATTTCATTTCATTTCCTTAGCATTGTAAACTTGCCTTTCTTTATTTTCTTGCTTAGC
AGATGTCTCCAATTGATGTAAAATCCCCAAAACACTGTGAAGAAAAAGGCTTCAAAGTAG
AAAATCTATTCCCAAAAAAGAAGTTATTCTTTTGCTTCTCAACAATTTCCCTCTCTATTC
TCTCATTCATCTTTCTTCTTTACCTCACACTTCATCCTACAAAACCAAATTTCACATTAA
GAGAAGCTGATATTTATCAACTCAATCTCTCAGGTCCACGCCAACTGCTTAACTCGTCTA
TACAACTCACCCTCGTATCGAAAAATCCAAATAAGAAAGTTGGAATTTACTACGATGAAT
TGCAAGTGTTTGCTTCTTATAAAGGACAACAAATTACTCTTCATACTTCTCTTCCTCCAT
TTTATCAAGGCCATGAAGATAGTAATTTTTTATCGGCTTTGTTGATTGGGAATGGATTGC
CAGTGGATCCTTATTTTGGTTATGAGGTGCAACGTGACCAAAGTGTTGGAAAACTGATTA
TGAATTTGAAAGGAAGTGGTAGGTTGAGATGGAAAGTTGGAACTTGGGTTTCTGGGAAGT
ATAGGTTTAATGTTGATTGTGTTGCTATTATGCCTTTTGGATCTTCCTTGCCATCTGCTC
CGCTTAGTTTTAGACAAGGAGCGCAATGTTCTACCACTCTTTGAATTAAATATTACTAGA
AATAATTAATTAAAGCCCTTCCTCACATAGGGAGTATATTGTTCTTCTTTTAATTTCATA
TATATTTTGTATGATTATACTATTGTAAATTATCTTTTGATGAAAGGTACTTGAGTATAC
ATCCGCCAAATTAAACTAATCGCGTTGGGTCTATTGTACACCATATATATTTG