Microarray Probes on PGSC0003DMT400001503

Probe IDChipProbe Sequence
CUST_17466_PI426222305 JHI_St_60k_v1 GACAGAATTACGAAGAAAACTAAAAGAGTTGCAAAAGTGTTGTCACCCCTGCCGGCAGCT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400001503

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400001503 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G24580.1 +2 8e-60 196 97/128 (76%) Heavy metal transport/detoxification superfamily protein | chr5:8410394-8412087 REVERSE LENGTH=319

Transcript Sequence (911 bp)

>PGSC0003DMT400001503 911 pgsc_dm_v3.4
GTACCTTGGAGCAGGGGTTGAGGGGGTAGTAATAGAGATGGCGAAAAACCAAGTGACAAT
AAAGGGAGTAATAGAGCCACAAGCAGTGTGCGACAGAATTACGAAGAAAACTAAAAGAGT
TGCAAAAGTGTTGTCACCCCTGCCGGCAGCTGAGGGTGAACCAATTCCTGAAGTTGTTGC
TTCACAGGTAAGTGGATTGACTACTGTGGAGCTTAATGTCAACATGCATTGTGAGGCCTG
CGCTGAGCAACTTAAAAAAAAGATTCTCAGAATGAAAGGTGTTAGAAGTGCGGAAACAGA
AGCCAGCACTGGCAAAGTAACGGTGACAGGCACTATGGACGCTAACAAGCTCGTCGACTA
TGTCTATCGACGCACCAAAAAACAAGCCAAAATTGTCCCACAGCCCGAACCTGAGCCCGA
AAAGCCCGTTGAAGAGACCAAGCCCGACGAGGCAAAGCCCGTTGAAGAACCAAAGCCCGA
AGATAAGAAAGATGACGGTGCAGCCCCCGCTGAAAATAAAGAAGGGGGCGACGGTGAAAA
ACCACCGGAGGGAGAAAAAAACGAAGGCGGTGGCGGAGGAGAAGAGATGATCGTTCCAAT
TGAAGATCATTATGATGAACATACGATTAATAAGTTGATGTATTATCATCAGTATCAGCC
ACTTTACGTCATTGAAAGAATTCCACCTCCACAGCTATTTTCCGATGAAAACCCTAATGC
ATGTTGCATTACATAATTAATAAACCTGCAAGCAATTATAGTACCTACTTAATTAATCAA
TCCTCACACTAAGTTTTTATGATATTGTGGGACGATGATTAATTTAAACACGTAGGAGTA
TTTAATTTGATTTGTTGTATTGATGGTCATGTGAAGGGGATTATTCTATCTCTAGATGAA
TAATGATAAAT