Microarray Probes on PGSC0003DMT400001358

Probe IDChipProbe Sequence
CUST_1235_PI426222305 JHI_St_60k_v1 GTTGTTTCATTCACAAAGATTTTCATGATGTCGTTGACAGAATGAGTCTTCTCAACAAAC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400001358

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400001358 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG) Solyc02g087110.2 +2 0.0 1209 593/634 (94%) genomic_reference:SL2.50ch02 gene_region:44197070-44202789 transcript_region:SL2.50ch02:44197070..44202789+ go_terms:GO:0016165 functional_description:Alpha-dioxygenase (AHRD V1 **-- Q5GQ66_PEA); contains Interpro domain(s) IPR002007 Haem peroxidase, animal
TAIR PP10 AT3G01420.1 +2 0.0 923 447/624 (72%) Peroxidase superfamily protein | chr3:159689-162726 REVERSE LENGTH=639

Transcript Sequence (2359 bp)

>PGSC0003DMT400001358 2359 pgsc_dm_v3.4
CGTGCGTTTATGCTTTTATACTTATCTCTATATATATAGAAGGGATATGTTTCCTCCAAA
ATTAAGCATTTAGAGCCCTATATATATTACAAGTGATTTCTAGCTTGTAGGAAATTAAAT
TAACAATATGTCTTTTGTTAATCTCTTGCTATTTCCTCTTCGTTGTTTCATTCACAAAGA
TTTTCATGATGTCGTTGACAGAATGAGTCTTCTCAACAAACTTTTGTTTATGATGGTTCA
CTTGGTTGATAAATTGAACCTGTGGCACCGGCTACCGGTGTTCTTGGGGCTACTTTATCT
CGCAGCACGGCGACATCTTCATCAGGAATATAATTTGATCAACGTCGGTGTCGGTAGAAA
ACCTATCGACGTTACATCAAATCGGGCCGTTGGAAAATACAACGACCCTTTTAATGAAGG
AGGTGGCAGTGAATTTCCTTTCTTTGGTAGGAATATGATGCCTGTTGATCAACATGAAAA
GTTAAAGAATCCAGATCCTATGGTAGTTGCAACAAAGCTACTAGCACGCAGAAAATTCAT
AGACACAGGAAAACAATTTAACATGATAGCTGCCTCATGGATACAATTTATGATTCATGA
TTGGATCGATCATTTGGAAGATACTCAACAGATTGAGCTAAGGGCACCTGAAGAAGTTGC
AAGTGAGTGTCCTCTCAAGTCCTTTAAGTTTTTCAAGACCAAGCAAACTCCTACGGGTTT
ATGTGATATCCAGACTGGTCACTTGAACATTCGTACTCCACAATGGGATGGAAGTGCTAT
TTATGGGAACAACGCAGAAGTTTCAAAGAAAGTGAGGACATTTAAAGATGGAAAATTGAA
ACTATCAGAAAATGGGCTCCTTGAACAAGATGAAAATGGAAAAATCATCTCTGGTGATGT
TCGCAATAATTGGGCTGGACTTTTGTCACTGCAGGCACTCTTTGTTCAAGAGCATAATCT
TGTTTGTGACACCTTGAAGAAAGAATATCCAGAATTGAAAGATGAGGACTTGTATCGTCA
TGCAAAGCTTGTCACTTCTGCTGTAATTGCGAAAATTCACACCATAGATTGGACAGTTGA
ACTTCTCAATACCGACACCCTTCTAGCAGGAATGCGCGCCAATTGGTATGGATTGCTAGG
AAAGAAATTCAAGGATACATTTGGGCATGTTGGAGGTTCCATTTTAGGTGGTTTTGTGGG
AATGAAGAAACCTGAGGATCATGGTGTGCCTTATTCCTTAACTGAGGAATTTACGAGTGT
CTATCGGATGCATCAACTCCTACCTGATACGCTTCAGCTAAGAAATATCGATGCCACGCC
TGGACTAAACAAATCTCTTCCTTTGACTAATGAGATCCTGATGGAAGATTTAATTGGGGG
TAAAGGTAAGGAGAATCTATCAAGAATCGGGTTTACTAAGCAAATGGTTTCAATGGGCCA
TCAAGCTAGTGGAGCTCTTGAACTTTGGAATTATCCGATATGGATGAGGGATCTTATTGC
CCAAGATGTCGATGGAACTGACAGGCCACATCATATTGACCTTGCAGCTCTTGAAATTTA
TAGGGACAGAGAAAGGAGTGTTGCTAGGTACAATGAATTTCGTAGGAGAATGCTTCAAAT
TCCCATCTCCAAATGGGAAGATTTGACAGATGATGAGGAAGTCATTAAAACTCTTCATGA
AGTTTATGGTGATGAAGTAGAACAATTGGATCTGTTAGTTGGAATGTCCGCGGAGAAAAA
GATTAAGGGATTTGCCATCTCTGAGACTGCCTTTATCATATTTCTAATCATGGCATCAAG
AAGGTTAGAGGCAGATAAATTTTTCACCAGCTATTACAACGATGAGACATATACGAAAAA
AGGACTTGAATGGGTGAATACAACAGAAAGCTTAAAAGATGTACTAGATCGACATTATCC
AGAGATGACTGAGAAATGGATGAACTCCAACAGCGCCTTTTCTGTTTGGGACTCGTCTCC
AGAACCTCACAATCCTATTCCACTCTACTTTCGCGTTCCTCGGACATAGGCCCCTTCTCA
TTATACTTAAAATCAAAATAAAAAGAAGTAAGATGTGTGTCGATTATTTTTTCACCTGCA
AGTGCGTATTATGATTTCCATGTACTATCTTCACTACTTGTTTCATTCACTGAGCCGTTT
TATGAAACTATATATATCAGATTGTAATATGAATTTCCTGATATTTTTGTCCAATAAAAA
AAGAGAAACATGTGGTTTGTTTTATATCTAAGAGTCTTTTCTACATTTTTATTGTTTCAA
ACACATACTTTAACCAACAAACTTGTATAATTGGCTGAATTGAACAATTAGCATTCTTGT
ATTATATAGTGAATTTGGC