Microarray Probes on PGSC0003DMT400001330

Probe IDChipProbe Sequence
CUST_1064_PI426222305 JHI_St_60k_v1 TTATGTTGGCAACTGCAAATTCAACCAAAATCCTAACAAGAGCTGCTTCTCTGCAGATAG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400001330

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400001330 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG) Solyc02g087000.2 +2 0.0 923 469/477 (98%) genomic_reference:SL2.50ch02 gene_region:44137630-44143256 transcript_region:SL2.50ch02:44137630..44143256+ go_terms:GO:0009674 functional_description:Potassium transporter (AHRD V1 **** D2JYH2_GOSHI); contains Interpro domain(s) IPR018519 Potassium uptake protein, kup IPR003855 K+ potassium transporter
TAIR PP10 AT5G14880.1 +2 0.0 710 360/482 (75%) Potassium transporter family protein | chr5:4814244-4817667 FORWARD LENGTH=781

Transcript Sequence (1684 bp)

>PGSC0003DMT400001330 1684 pgsc_dm_v3.4
TACCAAGTTGAAGTGCTTTATGTTGGCAACTGCAAATTCAACCAAAATCCTAACAAGAGC
TGCTTCTCTGCAGATAGCTTTTACCTTTGTTGTTTACCCATCATTAATTCTTGCTTATAT
GGGACAAGCTGCGTATCTTTCCAAGCATCACGTTATCGCAAGTGATTACCACATTGGGTT
CTATGTATCAGTACCTGAAAAACTACGCTATCCTGTTCTAGCTATTGCAATACTTGCTGC
AGTGGTTGGAAGCCAGGCCATCATCACTGGGACGTTTTCCATAATCAAGCAATGTTCTGC
TTTGGGTTGCTTCCCAAGGGTCAAAATAGTACATACATCATCCAAAATCCATGGGCAGAT
TTACATTCCAGAGGTAAACTGGACGTTGATGGTGCTATGCTTGGCAGTTACGATCGGCTT
CCGTGACACAAAACACATAAGCAATGCATCAGGTCTGGCAGTTATAACTGTTATGCTGGT
CACTACCTGCTTCATGTCTCTAGTCATTGTCCTCTGTTGGCACAAAAACGTGTTGTTCGC
CATTTGCTTTATATTCTTCTTTGGTTCCATTGAAGCCCTCTACTTTTCAGCTTCCCTAAT
CAAGTTCCTCGAAGGTGCCTGGGTACCGATTGTTCTCTCTTTTATATTTCTAGCTGTCAT
GTATAGTTGGCATTACGGAACCCTGAAGAAGTACGAGTTTGATGTTGATAACAAAATTCC
CATCAACTGGCTGCTCACCTTGAGTCCCAACCTGGGTATTACCCGGGTCCGTGGCATTGG
TCTGATTCACACCGAGCTTGTTACAGGAATTCCAGCTATTTTCTCCCATTTCATCACCAA
CCTCCCTGCTTTCCACCAGGTTCTTGTTTTCCTTTGCATCAAGTCCGTCCCAGTACCTCA
CGTGAGACCTGAAGAAAGGTTCCTTGTTGGAAGAATCGGACCCAAAGAGTACCGTGTCTA
CAGATGCATAGCACGATATGGTTATCGAGACATTCACATGGACGACGTAGAGTTTGAAAA
GGATCTAGTTTGTAGCATAGCTGAATTCATCCGCTCAGAGGGACGAGGACAGAGTTTTGA
AGCTGTAGAAGATATAGACGCCAATGAAAGGCTGACGGTTATTGGGACAACTTCAACACA
CATTGATGGGATAAGAATATGCGAGGACAACGGAGGGTTGACTCATGTAGATACAGAAAT
GATAGAGATCAGCTCGCCAGAAGTACCACGAAAAAGAGTAAGATTTCTGGTGCCAGAGAG
TCCACAAATGGATTTAAGCGTTCGCGAAGAGTTGCAAGAACTCATGGAAGCTAGGGAAGC
AGGGATGGCATTTATACTTGGTCATTGTTATGTTAGAGCTAAAAGGGGTTCAAGTTTGAT
AAAAAAACTGGTGATTAACATAGGATATGACTTTTTAAGAAGAAATTGTCGTGGACCAAC
ATATGCATTGAGCTTCCCTCAAGCTTCAACTTTGGAGGTTGGAATGATCTACCATGTATA
ATTTGTGCTTTTACTTTTTTTCTAATTAAAGGATAGAATTGTAGCATATGTTTTTTTTAA
AATTCGAAAAGCTTTGTAAATGTTGTAATGGTACATGAGTTTTTGCTTTATGCAAGGCAA
TAAATACCACGAGAAAAGGAAATACTGAGCTTTAGAGGCATGTATGTTTGAATAAAGGGA
TAAA