Microarray Probes on PGSC0003DMT400001280

Probe IDChipProbe Sequence
CUST_1251_PI426222305 JHI_St_60k_v1 GCAGAAGTGTTCATTTGAACTGCTTTTTCATTTACCTCTTTTTGAACATTTCCAACCTCA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400001280

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400001280 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG) Solyc02g086710.2 +2 4e-152 439 237/241 (98%) genomic_reference:SL2.50ch02 gene_region:43930486-43935980 transcript_region:SL2.50ch02:43930486..43935980+ go_terms:GO:0005524,GO:0016656 functional_description:Monodehydroascorbate reductase (NADH)-like protein (AHRD V1 **** Q0WUJ1_ARATH); contains Interpro domain(s) IPR013027 FAD-dependent pyridine nucleotide-disulphide oxidoreductase
TAIR PP10 AT3G27820.1 +2 5e-131 385 204/241 (85%) monodehydroascorbate reductase 4 | chr3:10315249-10317881 FORWARD LENGTH=488

Transcript Sequence (913 bp)

>PGSC0003DMT400001280 913 pgsc_dm_v3.4
ATTTGAAAAGGGTAAGATTTTAAATTTGGGATTTTTGGTCCTTTGAATTTTGGGGAAAGG
GGAAATGGGTAGGGCCTTTGTGTATGTAATATTGGGAGGAGGAGTTGCTGCTGGTTATGC
AGCTCATGAATTTGTTAAACGAGGTGTCTCTCATGGCGAACTATGCATCATCTCTGAAGA
ACCTGTTGCTCCTTATGAACGACCGGCATTAAGCAAGGGTTATTTACTACCAGAAGATCC
TGCACGTCTGCCTGCTTTTCATTGTTGTGTTGGTTCAAATGAGGAAAGGTTGACGCCGAA
GTGGTACAAGGAAAACGGCATTGAGCTGGTCCTTGGAACTCGTGTAAAATCAGCTGATGT
GAGACGGAAGACATTGTTGACTGCAACTGGTGAAACCATAACCTACAAGATTCTCATAGT
GGCAACTGGTGCTCGGGCTTTGAAGCTTGAAGAGTTTGGAGTGAGTGGCTCAGATGCTGA
GAGTGTATGTTATTTACGAGATTTGGCTGATGCAAACAGGCTGGTTAATGTGATGCAATC
CAGCGGTGGTGGCAATGCTGTTGTAATTGGTGGTGGCTACATAGGAATGGAATGTGCTGC
TTCTTTGGTTATCGGCAAAATAAATGTCACCATGGTCTTTCCAGAAGCACACTGTATGGC
CCGCCTATTTACTGCTAAAATTGCAAGTTTCTACGAAGAATTTTACCGGTCAAAAGGAGT
TAAGTTTGTGAAAGGAACGGTATTGACATCATTTGATTTTGACTCCAATGATAAGGTAAA
GCCTGTTGCTTGCTTCACTTAGGCGGCGTTTGCTTGATAGCTTTTCGCAGAAGTGTTCAT
TTGAACTGCTTTTTCATTTACCTCTTTTTGAACATTTCCAACCTCAATTTGACTAGTTAC
TTTGTTAGTGCAA