Microarray Probes on PGSC0003DMT400000694

Probe IDChipProbe Sequence
CUST_3228_PI426222305 JHI_St_60k_v1 GGAGGGTTGATGTTGTTGCAACGAGTTTGAGTTTAAATTTTATGCACGATGTAGATAATA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400000694

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400000694 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G61890.1 +3 2e-64 210 114/219 (52%) homeobox 12 | chr3:22914346-22915239 REVERSE LENGTH=235

Transcript Sequence (1359 bp)

>PGSC0003DMT400000694 1359 pgsc_dm_v3.4
GTTACAAGTTAAAGAATTCCCCACCAGAGCTGAACACCATAAAGATACCATTCTATCAAC
TGTCAACTACTGCCACAGAGATACATGAACATTCCAGTTCCAATCCACACACATAGATAT
ATCCCAAATCAAGAAATTTCACAAATAAGATGTTTGATGCAGGGGAATTTTCTCCAAGTT
CTTCAACAGCTGCTCTGTCTGCAGAGTGTTTCAGTAGTAGCAGCTGCTTCAGCAGTCTGT
CATCCTCAAAGAAGAAGAAGATTAACAATAACAACGCGAGGAGGTTCAGCGATGAACAGA
TAAAATCATTAGAAACGATGTTCGAAACAGAGACCAAACTTGAACCAAGAAAGAAGCTGC
AACTAGCCAGAGAACTCGGATTACAACCTCGACAAGTAGCAATTTGGTTTCAAAACAAGA
GAGCTCGATGGAAATCGAAGCAACTCGAAAGGGATTACAGTATACTTAAATCAAATTATG
ACAATCTTGCTTCCCAGTACGAATCTTTAAAGAAAGAAAAACAATCCTTGCTTATTCAGT
TGCAAAAACTGAATGATGTGATGCAGAAAGAAAGGGGGAAGTACTGTTGCAAGCAAGAAA
TCGAGTTAGACAACAGATGTGCTGCAATTAAGAAAAATGAAATGGAAGGGATGCCAAGCT
TGTCTTTTGACTTATCATCTCAGCATGGAACAAATGGTGTTATTTCAGATGATGACATTG
ACAGCAGTATAAAAGCTGATTATCTCGGGTTAGATGACGATGCAGTACATCATCTACTGA
AAATTGTTGAAGCAGGGGATAGTTCTTTAACTTCCCCTGAAAATTGGGGCAGTCTAAACG
ACGATGGTATCTTAAACCATCAGCCTAATAGTTCTAGTTATGATCACTGGTGGGATTTCT
GGTCTTGAATCAGAATTGTCGACAACATATACACATCTAAAACGTTGGCTTTAGAAATGA
TCAGATGCCAAATTGCTCGCGACTCTTGTACATTTGATCGAGCATGCTGGGCATCCTTTG
TTTTCACTTTCATAAGAGTTGAGTTTACCTCAGCCTTACAGTGCCTTTGTCTACTTGACA
AACTGTAATCTTGTATACTAGTACTAGTCCATGGTGATTTTAGTTTGTATGCCTTGAAAT
ATGCTACTTGTAATACGTAGTAATTATCAGATCAGAATAGCTGAGAAGTATAATTTCCAG
CAGCTCGTAATCAGAGATATAGTTTAAAAGAAAGTAACCACACAGAATAGAAGCTATTGG
AGGGTTGATGTTGTTGCAACGAGTTTGAGTTTAAATTTTATGCACGATGTAGATAATAAA
TAATCTGCTATTATAAGTTAAACTATAGTGTTTGTCGTG