Microarray Probes on PGSC0003DMT400000593

Probe IDChipProbe Sequence
CUST_3284_PI426222305 JHI_St_60k_v1 CACCCTATGGATGCTTCTTCCTACAACTTCTTCTAAATTTAGTGTCAGTTATAACCTTTA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400000593

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400000593 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G46330.1 +1 3e-21 83 42/63 (67%) arabinogalactan protein 16 | chr2:19018730-19019108 REVERSE LENGTH=73

Transcript Sequence (406 bp)

>PGSC0003DMT400000593 406 pgsc_dm_v3.4
TTGCAAGATAATTACATTTTTTTTCTCTCTTGAGTAAGAAAGGGTGGGGGGATATTAGTT
ATGGCTTTTGTAGTTTCATTGTTGTTGGCCATCTTTGCCATGGCTTTTTTCACTGTTCAA
GCTCAAGAATTTGCTCCTGCTCCTGCCCCTACTAGTGATGGAATATCTGTAGATCAAGGG
ATTGCATATGTGTTGATGCTGGTGGCTTTAGTTCTAACATATCTCATTCACCCTATGGAT
GCTTCTTCCTACAACTTCTTCTAAATTTAGTGTCAGTTATAACCTTTAAATTATGTTGCT
TTTTTGGGGAAATGGTTGTAATCATTCTTCATATGGATTTAATTGGTTAATCCATTCATG
TTTAATTTAATTTCTAGTAAATGGTAATATATTTAGTTGTCTTTTT