Microarray Probes on PGSC0003DMT400000553

Probe IDChipProbe Sequence
CUST_2807_PI426222305 JHI_St_60k_v1 CTAGGAGGAGTATTTTCAGAAATAGTTGTTAGCGTATGTATTGACAACTGATCTATGTAC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400000553

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400000553 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G01480.1 +3 0.0 628 315/482 (65%) 1-amino-cyclopropane-1-carboxylate synthase 2 | chr1:175862-178051 FORWARD LENGTH=496

Transcript Sequence (1753 bp)

>PGSC0003DMT400000553 1753 pgsc_dm_v3.4
GAAACACATAATACTTTTAATACAATTAGTTATTTATTAAAAGTATTTGAAGTTAAGCAC
TTGTGAGTTGTGTGCATTTTGTTAATTTTCATCTTCTTAATTCTCTTCACTTTTAAACTC
ATTTAGAAACAAAAAAAATGGGATTTGAGATTGCAAAGACCAACTCAATCTTGTCAAAGC
TGGCTACTAGTGAAGAACATGGCGAAAACTCGCCATATTTTGATGGGTGGAAAGCATACG
ATAGCGATCCTTTCCACCCTCTAAAGAACCCAAATGGAGTTATCCAAATGGGACTTGCTG
AAAATCAGCTTTGTTTAGACTTGATAGAGGATTGGATTAAGAGAAACCCAAAAGCTTCAA
TTTGTTCCAATGAAGGAATCAAATCATTCAAGGCCATTGCCAACTTTCAAGATTATCATG
GCTTGCCTGAATTCAGAAGAGCGATTGCGAAATTTATGGAGAAAACAAGAGGAGGAAGAG
TTAGATTTGATCCAGAAAGAGTTGTTATGGCTGGTGGTGCCACTGGAGCTAATGAGACAA
TTATATTTTGTTTGGCTGATCCAGGCGATGCATTTTTAGTACCTTCACCATATTACCCAG
CATTTAACAGAGATCTAAGATGGAGAACTGGAGTACAACTTCTTCCAATTCACTGTGAGA
GCTCCAACAATTTCAAAATTACTTCAAAAGCAGTAAAAGAAGCATATGAAAATGCACAAA
AATCAAACATCAAAGTAAGAGGTTTGATTTTGACCAATCCATCAAATCCATTGGGTACCA
CTTTGGACAAAGACACACTGAAAAGTCTCTTGAGTTTCACCAACCAACACAACATCCACC
TTGTTTGCGACGAAATCTACGCAGCCACGGTCTTTGACACGCCTCAATTCGTCAGCATAG
CTGAAATCCTCGATGAAAAGGAAATGACTTATTGCAACAAAGATTTAGTTCACATCGTCT
ATAGTCTTTCAAAAGACATGGGGTTACCAGGATTTAGAATCGGAATCGTATATTCTTTTA
ACGATGACGTCGTTAATTGCGCTAGAAAAATGTCGAGTTTCGGTTTAGTGTCAACTCAAA
CGCAATATTTTTTAGCCGCTATGCTATCGGACGAAAAATTCGTCGATAATTTTCTGACAG
AAAGTGCGATAAGGTTAGCTAAAAGACACAAACATTTTACCAATGGACTCGAAGAAGTGG
GAATTAAATGCTTGAAAAATAATGCGGGGCTTTTTTGTTGGATGGATTTGCGTCCGCTTT
TAAGGGAATCGACTTTCGATAGTGAAATGTCGTTATGGAGAGTTATTATAAACGACGTAA
AGCTCAACGTCTCGCCTGGATCATCATTTGAATGTCAAGAGCCAGGGTGGTTCCGAGTTT
GTTTTGCGAATATGGATGATGGAACGGTGGATATCGCGCTCGCGAGGATTCGGAGGTTTG
TACGTGTTGAGAAAAGTGGAGATGAATCGAGCGCGATGGAAAAGAAGCAACAATGGAAGA
AGAATAATTTAAGACTTAGTTTTTCGAAAAGAATGTATGATGAAAGTGTTTTGTCACCAC
TTTCCTCTCCTATTCCTGCCTCACCACTAGTTCGTTAGGACTTAATTAAAAGGGAAGAAT
TTAATTTATGTTTTTTTATATTTGAAAAAAATTTGTAAGAATAAGATTATAGAAGGAAAT
CTAGGAGGAGTATTTTCAGAAATAGTTGTTAGCGTATGTATTGACAACTGATCTATGTAC
TTTGACATCATAA