Microarray Probes on PGSC0003DMT400000443

Probe IDChipProbe Sequence
CUST_2920_PI426222305 JHI_St_60k_v1 GAACTCGGCTTGAAAGTTCCTCCAAAGAGAACAGGCTTTTCTTCTGGAAAATGGATCTAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400000443

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400000443 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G00550.1 +1 0.0 534 260/423 (61%) digalactosyl diacylglycerol deficient 2 | chr4:238154-240019 REVERSE LENGTH=473

Transcript Sequence (1251 bp)

>PGSC0003DMT400000443 1251 pgsc_dm_v3.4
ATGCAGGTCACTTTGGTTGTTCCCTGGCTGCCGCTGATAGATCAGGAACACTTGTTTCCC
AATAATATCACGTTTGATTCACACTTGGAGCAGGAAAAGCATGTCCGTCAATGGGTGGAA
GAGAGGACTGGATTTGAGTCGAATTTCAATATACGTTTTTATCCTGGAAAGTTCTCTCTA
GATAAAAGGAGCATTCTTGCTTTGGGCGATATTACAGTAATTATACCAGATGACGAAGCA
GATATTGCAGTCCTTGAGGAGCCCGAGCATCTTACATGGTATCATCATGGGAAGAGATGG
AAAGAAAAATTTCGTCTGGTTGTTGGAATTGTTCACACCAATTATTGGGAGATTGTCAGG
AGAGAGAGGAACATATTGGTAGCCCTCCTGATAAAGTACATTAATGGCTGGGTAGTCGAT
ATATATTGCCACAAGGATCTACCGAGATCTGTGGTCTGCAATGTGCATGGAGTTAATCCA
AAGTTCCTTGAGATTGGGCTGAAAACTAGGGAGAAACAGCAAAATGATAACCAAGCTTTC
AGCAAAGGTGTCTACTACATTGGTAAGAAGTTGTGGAACAAAGGGTACAAGGAGCTACTT
GATCTTTTACGTGATCATCAAAAGGAACTTCCTGGATTTGAGATCGATTTATATGGCAGT
GGTGAGGATTCTGCTGAAATTGAGGTGGCAGCTAAAAAGTTGGAATTGGCAGTTAGGGTT
CATCCTGGACGTGATCATGCAGATCCTTTGTTTCATGATTATAAGGTGCTCCTTAATCCA
AGTACCACAGATGTAGTTTGTACAACCTCGGCTGAAGCATTAGCTATGGGCAAGATAGTT
GTATGCGCCAACCATCCGTCAAATGAATTCTTCATGCAGTTCCCAAATTGTCGAACATAT
GATGATGGTGAGGGGTTTGTTAAAGCTATAGTCAAGGCATTGTCTGATGAGCCTGCCCCC
TTGACTGATGCACAAAGGCATGCACTTTCTTGGGAAGCAGCTACCGAGCGCTTTCTGAAA
GCAGCAGAGCTGGATACTCTGCCAACAAAGAATCAATCAAAAACTACCACTTCAGAGCCT
TTTCTCTCTACATCACTAAACTTAACCAAAAAACTCGAGGATGCATCAGCATTAGTTCAC
TTCGTAGGGACTGGATTTCTGAGCTCACAACCTGATGAAGAGCAATGTAAAGAACTCGGC
TTGAAAGTTCCTCCAAAGAGAACAGGCTTTTCTTCTGGAAAATGGATCTAA