Microarray Probes on PGSC0003DMT400000436

Probe IDChipProbe Sequence
CUST_2999_PI426222305 JHI_St_60k_v1 CACAACTCTGTGACAAGAAAGTGGATGATAATGTTTCATCATGTTCTTGATTTTGTCTTG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400000436

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400000436 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G45510.1 +3 0.0 650 312/509 (61%) cytochrome P450, family 704, subfamily A, polypeptide 2 | chr2:18753085-18754944 FORWARD LENGTH=511

Transcript Sequence (1775 bp)

>PGSC0003DMT400000436 1775 pgsc_dm_v3.4
CCAAATATACAACATTTCTGGAAAAAGAAATGGATATTCTCTATACAATGTTCACCTCTA
TAGCTATTCTCTTGTTCATTTGTGTGACTCCTATATTAGTTTTAATAGTAAGGATCTATG
CTGGCAAGTCAATCAGAAACCCCAAATATGCACCAGTGGAGGGGACTGTGTTCCATCAGC
TCTTATACTTCAACAGGATGTATGACTATCAAACAGAATTGGCTAAAAAGGCCCCTACTT
TCCGGTTTCTGGCGCCGGATCAGAGTGAAATATATACCACTGATTCAAGAAATGTTGAAG
ACATTCTTAAAACCAACTTTGGTAAGTACTCCAAAGGCGAACGGAATCAAGAGATTATAA
TGGATTTGTTTGGGGAAGGGATTTTCGCGGTAGATGGTGAGAAATGGAAGAAACAGAGAA
AGCTTGCAAGTTTTGAGTTCTCAGCTAGAGCATTGAGAGACTTTAGCTGCAAAGTTTTCA
GAAAAGGAGCAGCCAAATTGGTCAGCAAGGTTTCTGAGTTCTCTCTTGCCAACCAAGTTT
TTGATATGCAAGAACTGCTAATGAGAGGCTCCCTGGATTCAATATTTAAAGTTGGCTTTG
GAGTTGATCTGAACTGCCTGGAAGGGTCAAGTGGAAATGATAACAAATTCATTACGGCCT
TTGATGATTCAAATGCATTGTCATATTGGCGTTATGTCGATCCATTCTGGAAGCTTAAGA
GATACTTCAACATTGGGTCTGAATTTCTCCTGAAAAAGAACATCAAATTCATCCGAGAAT
TTGTTGATGAATTGATTAGAACAAGGCGCAAACAGCTAGAGATGAAACAAGATTCTATGG
ATAAGGAGGACATACTCTCAAGGTTTCTGGTAGAGAGCAAGAAGGATCCAGAGAAAATGA
CTGATCAGTATCTCAGAGATATTATACTGAATTTCATGCTTGCTGGCAAAGATAGTGCTG
CTAATACTCTTTCATGGTTTTTCTATGTGCTTTGCAAGAACCCCTTAATCCAAATAAAGA
TTGTTGAGGAAATAAGAGAAGTTATTGGTAATAACATGAAGGATAATGGAAGTGTGGATG
ATTTTGTAGCAAGTATTACAGAAGAAGTCCTCGAGAAAATGCATTATCTTCATGCAACAT
TGACAGAGACCTTGAGGCTATACCCTGCTGTCCCATTGGATGGAAGGTGTGCGGATGCAG
ACGATGTTCTTCCTGATGGCTTTCACATCAAGAAAGGGGATGGGGTTTATTATATGTCCT
ATGCAATGGGGAGAATGCCTTACGTTTGGGGGGATGATGCTGAGGATTTCCGACCCGAAA
GATGGTTGAAAGATGGGATTTTCCAGCCAGAGTCACCATTCAAATTCATAGCATTTCATG
CTGGTCCAAGATTATGTCTAGGCAAAGATTTTGCTTATCGGCAAATGAAGATAATATCAA
TGGCTCTTCTCCATTTCTTCAGGTTCAAATTATCCGATGACACGAAAGCAGTAACCTATA
GAACCATGTTTACACTCCACATCAAAGAAGGGCTTCAGGTTCATGCAGTTCCAAGAAGAG
GATTAGTAGAAGAATGAAATACAGAAAGCCACTTTCAAATTTCAATGTATAAAATGTCAT
ATTTAAAGCTAATCTACAGAGGTAATGACTGTCCATTCCTCCATATGAACTATAAGTTCA
ACTATTCACAACTCTGTGACAAGAAAGTGGATGATAATGTTTCATCATGTTCTTGATTTT
GTCTTGAAAGTAAGGAATGACTTCATATTAGCGAG