Microarray Probes on PGSC0003DMT400000324

Probe IDChipProbe Sequence
CUST_2764_PI426222305 JHI_St_60k_v1 CTTCATCATGTGTTGCTATATGTGTACAATATTTGATTATACGTGCCTAATCGCGCTATT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400000324

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400000324 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G53390.1 +2 4e-72 243 126/278 (45%) O-acyltransferase (WSD1-like) family protein | chr5:21656951-21659207 REVERSE LENGTH=486

Transcript Sequence (1867 bp)

>PGSC0003DMT400000324 1867 pgsc_dm_v3.4
TGCTAGATCGTATAGTTTGATTAATATGGAGTGTGGTGGAAAGAAAATGGTTCTCAAGCC
TATACGAACATCAAAGAAATTAAATGATGGTGATGAAGAAGAAGCAATATTATTGAGTCC
AGGTTCTCGAATGTTCCATGAACCTAACTACAATATTCACATTGTAGCAATCATGGGTTG
GAAAATACCACTAGATATTAACTCTCTCAAAGCCCAAATACTAAGCAAGTTGCTTAAACA
TCCACGCTTCTCCAGTTTGCAGGTTATGGATGAGAGTGGAGAAATGAGATGGGTTCCGAC
GACAGTGAATATAGATGATCATGTCATAGTACCCCAGCTGGATACTATTAATAATACTAT
GGACACAGACAAGTTGGTCGAACAGTATATGTCAAACCTAAGCACGACAACTATTGACAT
ATCGAAACCTCTATGGGATATTCACATACTTAACGTGAAAACATCCCATGCTGAGGCAAC
TTCTATTTTCCGTTTTCACCATTCTCTTGGAGATGGAATTGCCCTTATGTCCCTCTTACT
CTCTTGTTTTCGAAAAACATCGGATCCTACTTCTTTGCCTACACTTCCAGTTTCTTCGAA
GAACAAATCGAATAGTAAAAATATTAGGTCGTTGATATGGCAGTACATTGTGAAGTTGTG
GCTGTTCATCAGGCTTTTGTTCAATACAGTTGTTGATGTTTTGCTTTTTATAGCGACTGC
TTTATTCTTGAAGGATTCTCAATCACCTTTTACAGTTGCAAAAGGATTTAACAAAAAGCA
CTCTACTGGCCAGAGATTTATCTATCGGACTGTTAGCTTGGATGATATTAAATTTATAAA
AAATGCGACAAACGCTACGATTAACGACGTTATTTTGGGAATAACACAAGCGGCTTTGTC
TCGTTATATCAACCGAAAATTCGGTAATTAATTAAGCTCTTTTTGTATAAATTCGCCGCT
ACCCAAAGGGGGCTAAAATGCTATAGTGAATTTACTTCTCTTAACTAGATGTTGAAGGCA
AGATGAAAGAACAAATGAGATGCAGAGCCACTGTTCTAGTGAATCTGAGACCAGCTTTGG
GAGTTCAAGTCAGTATTTCTTCATCATGTGTTGCTATATGTGTACAATATTTGATTATAC
GTGCCTAATCGCGCTATTAATTAATTATCTATAAAATGACAGGCCGTAGCAGAAATGATT
GAGAAGAATGCGATAGTAATACAAGGAAATTGTTTTGGCTTTGTCATAATTCCTTTAGAT
ATAGCTCAATTACAAAATCCTCTGGATTATGTTCACAAAGCTAAGATATCAATGGATCGA
AAAAAGCGTTCTCTTGAGTCTCAATGTACCTTTTACATTTTACAGCTTTTCCTCAACTTG
TTTGGCTTTAAGGGTGCAACAAAACTTGCTAATAGAGTTCCATCTCAAACAACACTAGCT
TTTTCAAACGTAGCTGGTCCACTTGAAGAAGTTTCTTTCTCAGGCCATCCATTGGCATTC
CTTGCCCCTACATGCTATGGCCAGCCCACTGGGTTAATGGTTCATGCGTGTAGCTATGCG
AAGAAGTTAACATTTGCTATAACAGTTGATGAAGGAATGATTTCAGATCCTAACCAGCTT
GGTGATGATTTTGTCCATTCATTTATAAGCATCAACGAGGCTGCTCTTTCAAAATTCAGA
ACCAAAGTTGATTAGCTCATTACACTTTTAAAATTTATATTTTGTTATTTAATACTGTAA
TGGCTATACATTGTAATAAAGTAGAATTATTATCCTTGTGTTTGTACCAATTTTATGGTC
AATAATTAGATCACTTCCTATAAAGGAAAAATAACTGCAGCATTTGAGTTATCCAGCTTG
AATTTAG