Microarray Probes on PGSC0003DMT400000247

Probe IDChipProbe Sequence
CUST_2978_PI426222305 JHI_St_60k_v1 TTTGGCACTGAGGCGTGACAATATCGACTTCAAAGTTACTTGTTTGGTATTGAGGCGTGA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400000247

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400000247 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G46240.1 +3 3e-38 155 201/797 (25%) BCL-2-associated athanogene 6 | chr2:18986586-18989827 FORWARD LENGTH=1043

Transcript Sequence (4076 bp)

>PGSC0003DMT400000247 4076 pgsc_dm_v3.4
TGGGTTGAGCATCTGCTGAAGTTTTTTTTTTTCATAGGTAATTCTATACACACATAAAAG
GGAAGCTTAATTTGGACCTGCATTTGAACCAAGCTATGTATCCCATGAATCCTTACCAAC
GGAACCAAGTACCTTACAATCCTCATTATTATCCCCACTTCGAATCGAATCCTCATCATC
ATATGAACATTGATCCAACTAGATCTACATTACCTTATGAATCTTGGCCTTGTGGTGGTA
GCAGCTATGGGCATCCTTATCCACCTCAGTGTCACAGTTGCTGTATCCATAACAATTCTC
CGAGCCAGTGTGCATTTAGCCCTCCGTATCCTTACCTTCCACCACCTACATATCCTGTGA
TGTATCCTACTCATTATGTTCCTCCTCCACATTTTAGTATGGAGCAGCCCCGATACGAGT
ATGAAAAGAATATGGGCAGAGATCATCACTGTTGTGGTTGTTCAAATCATCAATGTGGTA
GTAAGAAAGGAGGAGGGAGCAGTGTCAAAATAGAAGAACATGGCCAGGATAAGAAAAACG
AAAGTAACGAGTCATTGGTTCCTTTTGGGTTCAAGAATTGTCCTTATCCAGTTGTGAGCT
TACCACCTGATGACATGAAGAATAGGGAGCACATGAAGCCTAATGGATCCAATTGTAAAG
AGGAGGAGGAGAATCCGCAAGTTGTGAAGCCGTTTGGCGATTTCAGGCCCTTCCAGCAAC
CAAATGTCTGGAATTTATGGCCTTCTCATTATGGGAACAGCTCAGAATCACCAAAGCAAA
CGGGAGATTTACCCGGAAAACAACAAGATGATGATTCGATCAGGAAGCAGTTTCCATTTC
CAATAATCTGGATGCCTTATAAGCCCGAGGAAGACGGAGAGAGAGTTGGTAAGGAAACTG
AGTCTGGCCTCATTGCTGAGAAGGAGCCAACCTCCCCCTCAAAATTAACCAAACCAATGT
TACATGATTCTGAAGACAAGAGAAGCAGTTCTAAAGAAAATGAAGTGATTAGCGGAAGTG
AAATCCGTGGAAAGGGACTGAATAAAGGGACTGTTGTGAAAATCATTCCTGTAAAGCAAG
TGGAGCAGAATGAGATCTTTGATGGAAAAAAAGAGGAGGCTTCCGAGAGGCATGAAAGTG
ATGCTAAACAGAAGAAAATTGCTCAAGAAGGTGGTAAGAAACAGTCCCCTTCTCCTACAA
AGTCATCGAAGTTGCCTCCTGTTTGTTTAAGGGTTGATCCCCTTCCTAGGAAGAAAAGCA
GTAATGGCAATTCTAGGTCTCCTAGTCCTCCTTGTGGGAAAGGGAAATTAGTAGAATCGC
GCAGTGAGAGCTCCAAACCTCCCATCCAATCAAATGAGAAGGAGAATGTTCAACTAGACA
AATCATCAACAACAAGCATGCCAAAAAAAAGCACAGAAGTGGAGCCAAGTAAAGGCAAGA
CAAAAGTTGTTGAGGTTGCCCAAGGGACATCTAAAGAAGATAAACTTCAGGATCAATGTA
CTGTTTTCTCTGATCTGAAACGCCAGGCAAGGAGCCAAACTGGTGAAGGCGATACTAGTA
AAGCGGCAAATAAGCCAAAAGATGAACCTGATGCAGTAGCTGCAAAAGCTCAGTCCAGCA
ATGAAGGACATCACAGAGGTGAGGCCAGAGAAGCAGCCAATGTAGATGTGGGTGCAGGCA
ATGAGATGAAACGAGTAAAGAGGAGTCAACTGTCCGATGATAAGGCAGCTACCATGATTC
AGTCGGTATACCGAGGTTTCAACGTGCGGAGATGGGAGCCTCTGAAGAAATTAAAGCAGA
TAGCCAAAATAGAGGAGCAGATGGCTGAGATCAAAAAACGTATTCAGGATTTGGAGAGCT
CAGCTGACAATGGAGTCGACAACAAACAGAGAACTATTATCACAGAAATCATAATGAGTC
TTCTGCTGAAACTAGACGCTATTCAGGGGTTGCATCCAGCTGTTAGGGAATATAGAAAAT
CCGTAGCGAAGGAGATTGTTAGCCTGCAGGAGAAGCTGGATCTTCTAAACTGTAAAAAGC
AACCAGCAGAAAGTGAAGAGACTTTTACTGCCAAATCTAGTGAGGATACATGCACGGCGG
TGGAAGACAACCCTTCCTTGCAGGGCCAAGAGGTGCAAAAGTTGGAAAGGGATGATGATT
TTACTAAGGGGGATGAAGGAATAAAGTTTGATGCAGAAGGACTTTGTGAAGAGCAGCCTC
TTTGTGCAACAGAGATGCTACCCGACTCCCATGATGTAGGCAATGCAGTACTAGAGGGAA
AAGAAGAAAACAAGGACGTTGAGGAGGTAATGGAAGGCGTTTCGGGCAGCAGTGCAGTGA
AGACAGGAGATGGAGCATCAGTAAAACCTTTTGAATCTGAAGAAAAAACAGATAAGTTGC
TTGATGAGAACACAGCAGTAGTTGAGAAATTAGAAGAGCGTGGAGATGGTGTGGATGAGT
TGGAAGAACTTCCTCGAGGAGTCCTTGATGAAGAGACCAGCATTAAAGGTTCTGCTGAAA
TCAGAAAAGACACAGTAGACCTTACTGCACTTACCCTTGACGAAAAAGTCTCTGATACAG
CGAGTCTAGAGCACCACCACTTGGAAGCATTGGGTGAAACACCATTTATTTTGGGGACGG
AGAATATGCACAGCAGCAATGGAGTAGAGGAAAATGCAGAAATTCTGGAAAGAGATGCAG
CAGTACCAATTGACATTCCCAAACGAGAGAAAGAAGATGCAAAACCATTAAGTGAAGATG
CAAACATATCCGATGTGGATGACAAGGTTGGTATGGAGAAGAATGAAAAAGAGCTTGATC
AAGGCGGTAGTGCATCAGATGGTTTTTCAATACCATCACAGGAAGACGCAATCACCACAG
AGCAGCCTACAGATACTACCAACGCAGAGGAATCAGAAACAGTTGAGGTTCTGCAGGAGA
AAATGCAAAATGCAGTTGACAAAGATATTGAAATCCTTGATTCAGGAAAACCAGTAGAAA
AATCGGTGGAACCTCAACTATCCACTGGTACCAATGACGAAGCTCGAGAGTACCATATTC
AAGATAAGCAGAAAATTGGGGAGGAAAATAAGGAGGTGCAAGGTGAGGAATTGCCAGTTC
GTGATGATGCTGTCGTCTCTGAACCTAATAATGAAGGAAAAGAGCGTAATGTGGTGGTTG
AGCAGCGGCTTGTGGAGGAGAGCTTTGAGATGCAAGGGAACGAACCAGTGGCTGCTGAAC
CAGAAACTGCCGATAATGCTGCACATGTGATCGAGGAACCAGTGGATGGAACTAAAGCTA
CGGCTGCTCCAGCATCAGAAGCTGTAACTACCGAGACAGACCTGTCAAGGGAGAAAGAGC
TTGGTGTAGCAGATGACCACAACACACATCGATCTTGTGATGCCGTGGAAGGTAATTCTG
TTGATACTTCCCATTCTTTTGGTTCTTCTACGCCTATTGAAGTACAAGTTATGGATGCAA
ACAAGCTTAAAGAATGGATGAAAGTGGACATGTCCCCATCGTCACCTACTGCCAGCCAAG
AATCCTGTGATAGTGATGCGCTGTCTGAGAGCGATAAAAAACTTATTGAGGAGAATGAAA
AATTAAGGGAGATGATGGAGAAGTTAATTAAATCAGGGAATGAACAACTGACTGCCATAT
CCAGTCTTTATGGAAGAGTTAAGGACCTGGAGAAGAGATTGTCTAAGAAGAAGAAGCTAA
AATTGAAACGAAATAGGGTACCAGCAGCTGGATCAGCCTGTGTAAAGCCATTGAATGACT
CACTTAGAAACAGGTCTGTGGGGTTGGCAATGTAAGAACAAAAAGCTTGGTGATTCCTTT
GAATGGAATAGTAGTTTGGTTCATGTAGTCTGTTTGTGTTCCATAGTATGCTATGTATAA
ATAAGGCTTTTTCTGCTCAGTTGTTGTTCCTTTTGGTTTTGGTTCTTATGCAATAGCGAC
TTTAAAGTTGCTTGTTTGGCACTGAGGCGTGACAATAGCGACTTCAAAGTTACTTGTTTG
GCACTGAGGCGTGACAATATCGACTTCAAAGTTACTTGTTTGGTATTGAGGCGTGA