Microarray Probes on PGSC0003DMT400000230

Probe IDChipProbe Sequence
CUST_3267_PI426222305 JHI_St_60k_v1 CTGATCGAGATAAGTAAGAAATCAGCATGTGATAAAGACACCCAAGCAGGTTATATTTTG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400000230

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400000230 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G23630.1 +3 2e-97 299 173/253 (68%) VIRB2-interacting protein 1 | chr4:12318070-12319574 FORWARD LENGTH=275

Transcript Sequence (1544 bp)

>PGSC0003DMT400000230 1544 pgsc_dm_v3.4
CATATTTCAAAATTAACTAAATTTAGGTTCGGAAAGCCGAGCCTCTGAGGCTCGGAGACA
TCCCTCGTTCACTTCACCGTTTTCAAAAACATAAATATCAATCGTTACACAATTTTCTCG
GCAATACAGTCGTTTCTTATTCACTCTCTCAGTCTTTGAAAATATCTGCTTTGGTTGATT
GAATCGGAGCTCTGAATCAGAAAATGGCCGAGCACGCTGAGAATTCGGATCCTAAAGGGG
AGTCGTTGATGGAGAAGATCGCCGACAAGTTTCACGGTGACGATTCCTCATCGTCGTCGG
AATCAGATACCGAGACGAAGAAGCCGGTAGTGAAATCGGAGGTAGAGGCGGAGCCGGAGC
CGGAGACGTTGAAGAACAAAGTTTGGAGGCTATTTGGAAGAGAAAAACCGGTTCACAAGG
TTTTCGGTGGAGGCAAACCTGCTGATGTATTCTTGTGGAGGAACAAAAAGATATCTGGTA
CTGTACTTGGTGGAGCAACTGCTATCTGGGTTCTTTTCGAATTGCTTGAGTACCACCTGC
TCACTTTAATCTGTCACATTTTGATCATCACTCTTGCAGTTTTGTTCTTATGGTCAAATG
CAACCACCTTTATTAACAAAAAACCTCCTCATATCCCAGAAGTCCACCTTCCAGAGGGCC
CCATCCTTCAGGTGGCTTCTGCCCTGAGGATCGAAATTAATCGCGCTCTTGATCTACTGA
GAGAAATTGCGTCAGGGAGAGAACTGAAGAAGTTTCTTGCTGTCATTGCTGGTTTGTGGA
TACTCTCAATTGTTGGTAGCTGGTGCAACTTTTTGACACTGTTCTATATATCATTTGTGC
TCCTCCACACAATTCCTGTTCTTTATGAGAAATATGAAGATAAAGTGGATCCATTAGCCG
AGAAAGCAATGCACGAGATCAAGAAGCAATATGCCGTGTTTGATGCAAAGGTTTTGAGTA
AAATTCCACGAGGACCACTGAAAGATAAGAAGAAGGATTAGATGTGGTGGTGCTTCGTTC
CTGCTAGAGAGATTTGGGTAGCTGCTCCACCTTTTCAAAATGTAATAGTGCTTCTCTTGT
TTTACATGAGGATGAGTGTTATCCTTGCTTATATTTGGGGTTTTATTAACTGGGGATAAA
TCTAGAAACAAACAGTTGGGAGGATTAGTCTGTTAGGTGTGAGTGTGTATTTGACTGTCG
TTTCACAGGATGTCATTGTATAAGTTCAACTAAATTTACATTGTGTTCTTCTGCACTTGT
TTGTATTGCTTTCACTTGTATCAACGTTGGGATGGTCCAACCTGTTGATACATAGCCGCC
TGAATCAAACTTGATCTGTCTGTTGTTCAGTTGGTTGATTCCAGTTTGTGGTTTCATTAC
TGGATTTGGGCTGGTATATGTACAGGAAGAAATGAAGATGTAAGGCTTATCAAATAATTG
GTGTAAGCTGTAAAATCTTGAGCTCTTCATTTATTGTCATTGTGCTGATCGAGATAAGTA
AGAAATCAGCATGTGATAAAGACACCCAAGCAGGTTATATTTTG