Microarray Probes on PGSC0003DMT400000220

Probe IDChipProbe Sequence
CUST_2887_PI426222305 JHI_St_60k_v1 AGATCTCTTACACTCTCAAATGCTCCGGCAGGGTTATAGTATCAGGAACAATTCCAGATC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400000220

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400000220 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G01470.1 +1 8e-56 180 83/151 (55%) Late embryogenesis abundant protein | chr1:172295-172826 REVERSE LENGTH=151

Transcript Sequence (879 bp)

>PGSC0003DMT400000220 879 pgsc_dm_v3.4
CTTTGAAGCTAAATAAATATCTATTCCTCAAGCACTACATAAATTTTCAATCTAGGTTTA
AAAATAGAAGCTAGAATGGCAGATTTCATGGAGAAAGCGATGAATTTCGTGTCGGAGAAG
GTGGGGAATATGGAGAAACCGGAGGCTGATATCACAGACTTTGATCTGAAAAAAGTTAGC
ATGGACAGCATTTCATATCATGCCAAAGTGGCCGTGAAAAACCCTTACTCTGTTCCTGTA
CCCATCATGCAGATCTCTTACACTCTCAAATGCTCCGGCAGGGTTATAGTATCAGGAACA
ATTCCAGATCCAGGGAATATAAAAGCAAATGACACAACCATTTTAGATGTGCCAGTGAAG
GTTCCTCACAGTATGCTAGTGAGTTTGGGTAAGGATATTGGTAAAGATTGGGACATTGAC
TATAAACTGGAATTGGGTCTCGCCATTGACCTTCCAGTCATTGGGAATTTCACAATCCCA
CTCTCTCATAGCGGCGAGATCAAGCTTCCATCACTCTCCGACTTATGGAACGGTGACAAA
GAAGAAGACACTGAAAAAGAGATCTGAAAGTAGCGCGCTAATAATAATATTACTACTAAC
TAATACTGTACTTTCATTATGGGTGTTTTTATGTATTTTGTTTGATTTTCCAAAAAGCCT
AAACCCAGTTTTGGGGTTTAATTAAAAATTACAAGTGTACTTTTCTTATTTTGTGCTGCG
CGCTACACTTTATTTTTAGTAGAACCACATGATATAATTAAGATATATATGGCACGGAAC
AAAGGTTTTTATGTGTATAGTATGTGCAACCTAACATGGGTTGTGGGTCGTGTACAGTTG
TAAAACTGCTCCACTCTTAACAGAGGTCTCAGGTTTGGA