Microarray Probes on PGSC0003DMT400000217

Probe IDChipProbe Sequence
CUST_3046_PI426222305 JHI_St_60k_v1 GTGATTCTAGATGCATTTAGAAGTACAGTAGCTGGATGATGGATATCTGCTAAATTGAGT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400000217

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400000217 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G61540.1 +2 3e-138 414 236/306 (77%) alpha/beta-Hydrolases superfamily protein | chr3:22773399-22775699 FORWARD LENGTH=515

Transcript Sequence (1643 bp)

>PGSC0003DMT400000217 1643 pgsc_dm_v3.4
CAAAATGCGGGCACTTCACTCATCATTCATAAAACCCCTCATTCGTCTTCATAGCCCATT
TTCGACTCCCATTATTTCACCATCTCCACTTCGAAAACAATTTCTCTACTTGCACTCCTC
CGCTACTACTTCACTCCAAAAGCTAACCGCCATGGCCGACAACAAGACGGCAGCCGTCGA
CGGCAACTCTACCTCTGACCACGTCTCCGACGCTTGGTACTCCGTTCCCGAGCTCCGATT
ACGCGATCACCGATTCACCGTTCCTCTCGATTACTCTATCGATCGCTGTTCCTCTACTAA
AATCACAGTCTTCGCTCGTGAAGTAGTTGCTGTTGGTAAGGAGGAACAATCTCTGCCATA
TCTACTATATTTGCAAGGTGGACCAGGCTTTGAATGCCCAAGACCAACTGAAGCTGGAGG
ATGGATAAGCAGAGCATGTGAGGAGTACCGTATTGTTTTAATGGATCAGAGAGGAACAGG
TCTATCAACACCATTAACACCATCATCTATGTCACAAGTGAAGTCTGCTGAGGATTTGGC
TAACTACTTGAGACATTTCCGAGCTGATAATATAGTACATGATGCTGAGTTCATCCGAAA
ACGCCTTGTCCCTGATGCTGGACCTTGGACAATACTTGGACAGAGTTTCGGAGGCTTTTG
TGCAGTTACCTACTTGAGTTTTGCTCCTCAAGGACTCAAACAAGCTCTTATAACTGGTGG
GCTCCCTCCAATTGGTGAAGGATGCACAGCTGATTCTGTTTATAAGGCAGGATTTGAGCA
GCTTGTTTGTCAGAACGAAAAATATTACAAGAGGTTTCCACAGGATATTGAAATTGTTCG
TGATGTTGTAAATTATTTGGCAGAGTCAGGAGGCGGGGTACCTCTTCCATCTGGTGGCAT
CTTAACACCTCGAGGACTACAACTTCTTGGTCTCTCAGGTCTAGGGTCAAGTACTGGTTT
TGAACGACTGCATTACCTGTTTGAGAGAGTCTGGGATCCTTTAATAGTTCAAGGAGCAAA
AAGGAGAATCAGTGACTACTTCTTGAATGCTGAGATGCTAAGGATCTGAAACTTTGGCCC
ATTTTGTGCGAATGTGCTAGCAGCATTTTCTTGGTGATTCTAGATGCATTTAGAAGTACA
GTAGCTGGATGATGGATATCTGCTAAATTGAGTTCTATGTGGCATTGCAGTATGAGAGAT
GGATCGGATTTGATGCAAACCCTTTATATGCTCTTTTGCATGAAAGCATATATTGCCAGG
GTGCCTCATCCCTGTGGTCTGCTCAGAGAATTAGGGCTCTAAATGACAACAAATTTGATG
CAATTGAGGCAGCAAAAGTTGGCCGCCCTGTACTTTTTACTGGAGAGGTGAGACACAATG
TGGTCGTTTTTGGTTAAGAACTGCCACAATATGAAGCAAGCGTCAAACAGAAAAAAAGTT
TTACTTCCACCTTAATTTCTCTGATACATCTTCCACATTAAAGGGTTCTGTCCTCGAGAG
GGCCTAAACTACAGCTTATATTTAACTAACCAAACCACCTCTCCTCATTATTGTTAACGT
AATATGTATGTCTTGCGCAAAAAAAATCACTATATATTCATAATTATTGGAAGTTATTAT
AGATATATGACAAGAGCTGTAAA