Microarray Probes on PGSC0003DMT400000129

Probe IDChipProbe Sequence
CUST_2845_PI426222305 JHI_St_60k_v1 CCGCGAAAAAAGGCATTGAAATTGTTACATTGATCGACCTACGATTGTTAAAGTTAAAAG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400000129

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400000129 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G01710.1 +1 3e-49 170 77/107 (72%) Acyl-CoA thioesterase family protein | chr1:262950-266029 FORWARD LENGTH=427

Transcript Sequence (812 bp)

>PGSC0003DMT400000129 812 pgsc_dm_v3.4
TCCAAGGTTTGCATCATCTCTTTCCTACACAGTTTGAGATATTGGTTCAGAGCAAAAGGA
AAACTTTCAGATGACCAGGCTTTACATAGATGTGTTGCAGCATATACATCAGATCTAATC
TTTCTTACAGTCAGTCTGAATCCTCACCGAAAGATGGGTTTCGAGACAAGTTCTGTTAGT
CTGGATCATTCGATGTGGTTCCACAGACCTGTGAGAGCTGATGATTGGATACTGTTTGTG
ATCAACAGTCCGACTGCTTATAATGCACGTGGCTTTGTGTGGGGGCAAATGTTTAATAAG
AAGGGAGAGCTCGTAGTGTCAATTACTCAAGAGGGCTTATTAAGGCCAGCCAGAAAATTA
CCTGCATTTCGACCAATGCTCTAATCCATGCCAGGTCGAATGAGAAAAGAGGACTAGTCA
CTACAGGTTCATTAGCAGTAACACTGCTGAAGAGCTCAAATAAATACTACAGAGGTCGCG
AATGAGAATAAAGATAGCGGGTTAACTTGTGATAGAGTTGAGCTATGACTGTATCTGTAT
TTTATCATACAGAAGTCAGAACTGCCCCGCCATTGTCTCTGTACCTCTCACCTCACCTTT
AAATATTCCTAACCCCCGCGAAAAAAGGCATTGAAATTGTTACATTGATCGACCTACGAT
TGTTAAAGTTAAAAGTTATTGTTTTTTTTTTTTACAAGTTTCATCTTCTACATTCACTAT
TAGAATAAACAATGTTGCAAACAATGATTTGATTTCAAGATGTCATTTGTTAAATGTCTT
TAGTTGACTCGTGTATGAACACTCACTCTTTG